Mouse Vanin-1/VNN1 Gene ORF cDNA clone expression plasmid,N terminal Flag tag

Gene

Species

Mouse

NCBI Ref Seq

NM_011704.3

RefSeq ORF Size

1539bp

Gene Synonym

V-1, Vnn1

Sequence Description

Identical with the Gene Bank Ref. ID sequence.

Description

Full length Clone DNA of Mouse vanin 1 Gene ORF cDNA clone expression plasmid,N terminal Flag tag

Plasmid

Promoter

Enhanced CMV mammalian cell promoter

Vector

pCMV3-N-FLAG

Restriction Site

Protein Tag

Flag

Tag Sequence

GATTACAAGGATGACGACGATAAG

Sequencing Primers

Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)

Quality Control

The plasmid is confirmed by full-length sequencing.

Flag Tag Information

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Screening

Antibiotic in E.coli

Kanamycin

Antibiotic in Mammalian cell

Hygromycin

Application

Stable or Transient mammalian expression

Storage & Shipping

Shipping

Each tube contains lyophilized plasmid.

Storage

The lyophilized plasmid can be stored at ambient temperature for three months.

Other Life Science vendor

Natural small molecules manufacturer | Biological Research Reagents Manufacturer

Background Information

Pantetheinase, also known as Pantetheine hydrolase, Vascular non-inflammatory molecule 1, Vanin-1, and VNN1, is a cell membrane protein which belongs to the CN hydrolase family and BTD/VNN subfamily. Vanin-1 contains one CN hydrolase domain. It is widely expressed with higher expression in spleen, kidney and blood. It is overexpressed in lesional psoriatic skin. Vanin-1 is also a member of the Vanin family of proteins which share extensive sequence similarity with each other, and also with biotinidase. The family includes secreted and membrane-associated proteins, a few of which have been reported to participate in hematopoietic cell trafficking. No biotinidase activity has been demonstrated for any of the vanin proteins, however, they possess pantetheinase activity, which may play a role in oxidative-stress response. Vanin-1 is an epithelial pantetheinase that provides cysteamine to tissue and regulates response to stress. Vanin-1 is expressed by enterocytes, and its absence limits intestinal epithelial cell production of proinflammatory signals. Vanin-1 regulates late adhesion steps of thymus homing under physiological, noninflammatory conditions. The early impact of vanin-1 deficiency on tumor induction was directly correlated to the amount of inflammation and subsequent epithelial proliferation rather than cell death rate. Vanin-1 molecule was shown to be involved in the control of thymus reconstitution following sublethal irradiation.

References

Aurrand-Lions M, et al. (1996) Vanin-1, a Novel GPI-Linked Perivascular Molecule Involved in Thymus Homing. Immunity. 5 (5): 391-405.

Grimmond S, et al. (2000) Sexually dimorphic expression of protease nexin-1 and vanin-1 in the developing mouse gonad prior to overt differentiation suggests a role in mammalian sexual development. Hum Mol Genet. 9 (10): 1553-60.

Meghari S, et al. (2007) Vanin-1 controls granuloma formation and macrophage polarization in Coxiella burnetii infection. Eur J Immunol. 37 (1): 24-32.

Catalog Number:MGI320-NF