Mouse USP5 Gene ORF cDNA clone expression plasmid,C terminal OFP tag

Catalog Number:MGI304-CO

Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
2508bp
Gene Synonym
ISOT, Ucht, ISOT-1, AA407472
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Mouse ubiquitin specific peptidase 5 (isopeptidase T) Gene ORF cDNA clone expression plasmid,C terminal OFP tag
Plasmid
Promoter
Enhanced CMV mammalian cell promoter
Vector
pCMV3-C-OFPSpark
Restriction Site
Protein Tag
OFPSpark
Tag Sequence
GATAGCACTGAG……CACCTGTTCCAG
Sequencing Primers
Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)
Quality Control
The plasmid is confirmed by full-length sequencing.
OFPSpark Tag Information

OFPSpark is a red (orange) fluorescent protein (excitation/emission maxima are 549 and 566 nm, respectively) derived from DsRed. Possessing high photostability and pH stability, OFPSpark is more than twice brighter than mOrange2. Fast OFPSpark maturation makes it clearly detectable in mammalian cells as early as within 8 hrs after transfection. OFPSpark can be expressed and detected in a wide range of organisms. Mammalian cells transiently transfected with OFPSpark expression vectors produce bright fluorescence in 8 hrs after transfection. No cytotoxic effects or visible protein aggregation are observed. For its monomer structure, OFPSpark performs well in some fusions and protein labeling applications.

Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
Background Information
Ubiquitin carboxyl-terminal hydrolase 5, also known as Deubiquitinating enzyme 5, Isopeptidase T, Ubiquitin thiolesterase 5, Ubiquitin-specific-processing protease 5, ISOT and USP5, is a member of the peptidase C19 family. USP5 contains 2 UBA domains and one UBP-type zinc finger. The UBP-type zinc finger domain interacts selectively with an unmodified C-terminus of the proximal ubiquitin. Both UBA domains are involved in polyubiquitin recognition. The UBP-type zinc finger domain crystallizes as a dimer linked by a disulfide bond between the Cys-195 residues of both molecules, but there is no evidence that the full-length USP5 exists as a dimer. USP5 cleaves linear and branched multiubiquitin polymers with a marked preference for branched polymers. USP5 is involved in unanchored 'Lys-48'-linked polyubiquitin disassembly. It binds linear and 'Lys-63'-linked polyubiquitin with a lower affinity. Knock-down of USP5 causes the accumulation of p53/TP53 and an increase in p53/TP53 transcriptional activity because the unanchored polyubiquitin that accumulates is able to compete with ubiquitinated p53/TP53 but not with MDM2 for proteasomal recognition.
References
  • Reyes-Turcu F.E., et al., 2006, Cell 124:1197-1208.
  • Reyes-Turcu F.E., et al., 2008, J. Biol. Chem. 283:19581-19592.
  • Dayal S., et al., 2009, J. Biol. Chem. 284:5030-5041.
  • Burkard T.R., et al., 2011, BMC Syst. Biol. 5:17-17.
  • TOP