Rat UCHL3 Gene ORF cDNA clone expression plasmid,N terminal Flag tag

Gene

Species

Rat

NCBI Ref Seq

NM_001110165.1

RefSeq ORF Size

693bp

Gene Synonym

RGD1561196, Uchl3

Sequence Description

Identical with the Gene Bank Ref. ID sequence.

Description

Full length Clone DNA of Rat ubiquitin carboxyl-terminal esterase L3 (ubiquitin thiolesterase) Gene ORF cDNA clone expression plasmid,N terminal Flag tag

Plasmid

Promoter

Enhanced CMV mammalian cell promoter

Vector

pCMV3-N-FLAG

Restriction Site

Protein Tag

Flag

Tag Sequence

GATTACAAGGATGACGACGATAAG

Sequencing Primers

Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)

Quality Control

The plasmid is confirmed by full-length sequencing.

Flag Tag Information

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Screening

Antibiotic in E.coli

Kanamycin

Antibiotic in Mammalian cell

Hygromycin

Application

Stable or Transient mammalian expression

Storage & Shipping

Shipping

Each tube contains lyophilized plasmid.

Storage

The lyophilized plasmid can be stored at ambient temperature for three months.

Other Life Science vendor

Natural small molecules manufacturer | Biological Research Reagents Manufacturer

Background Information

Ubiquitin carboxyl-terminal hydrolase isozyme L3, also known as UCH-L3, Ubiquitin thioesterase L3 and UCHL3, is a ubiquitin-protein hydrolase which belongs to the peptidase C12 family. It is involved both in the processing of ubiquitin precursors and of ubiquitinated proteins. This enzyme is a thiol protease that recognizes and hydrolyzes a peptide bond at the C-terminal glycine of either ubiquitin or NEDD8. UCHL3 is highly expressed in heart, skeletal muscle, and testis. UCHL1 and UCHL3 are two of the deubiquitinating enzymes expressed in the brain. These phenotypes indicate the importance of UCHL1 and UCHL3 in the regulation of the central nervous system. UCHL3 functions as a de-ubiquitinating enzyme where lack of its hydrolase activity may result in the prominent accumulation of ubiquitinated proteins and subsequent induction of stress responses in skeletal muscle. UCHL3 has also been identified as a tumor-specific antigen in colon cancer.

References

Wood,M.A. et al., 2005, Hippocampus 15 (5):610-21.

Kwon,J. et al., 2006, Exp Anim 55 (1):35-43.

Setsuie,R. et al., 2009, Neurochem Int 54 (5-6):314-21.

Setsuie,R. et al., 2010, Neurochem Int 56 (8):911-8.

Catalog Number:MGI230-NF