Rat UCHL1 Gene ORF cDNA clone expression plasmid,C terminal Myc tag

Gene

Species

Rat

NCBI Ref Seq

NM_017237.2

RefSeq ORF Size

672bp

Gene Synonym

Uchl1

Sequence Description

Identical with the Gene Bank Ref. ID sequence.

Description

Full length Clone DNA of Rat ubiquitin carboxyl-terminal esterase L1 (ubiquitin thiolesterase) Gene ORF cDNA clone expression plasmid,C terminal Myc tag

Plasmid

Promoter

Enhanced CMV mammalian cell promoter

Vector

pCMV3-C-Myc

Restriction Site

Protein Tag

Myc

Tag Sequence

GAGCAGAAACTCATCTCAGAAGAGGATCTG

Sequencing Primers

Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)

Quality Control

The plasmid is confirmed by full-length sequencing.

Myc Tag Information

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Screening

Antibiotic in E.coli

Kanamycin

Antibiotic in Mammalian cell

Hygromycin

Application

Stable or Transient mammalian expression

Storage & Shipping

Shipping

Each tube contains lyophilized plasmid.

Storage

The lyophilized plasmid can be stored at ambient temperature for three months.

Other Life Science vendor

Natural small molecules manufacturer | Biological Research Reagents Manufacturer

Background Information

Ubiquitin carboxyl-terminal hydrolase isozyme L1, also known as UCH-L1, Ubiquitin thioesterase L1, PGP9.5 and UCHL1, is a deubiqutinating enzyme with important functions in recycling of ubiquitin. Regulated proteolysis by the ubiquitin pathway has been implicated in control of the cell cycle, transcriptional activation, cell fate and growth, and synaptogenesis. The ubiquitin-proteasome system is involved in synaptic plasticity and is proposed to be part of a molecular switch that converts short-term synaptic potentiation to long-term changes in synaptic strength. UCHL1 is found in neuronal cell bodies and processes throughout the neocortex (at protein level). It is expressed in neurons and cells of the diffuse neuroendocrine system and their tumors. UCHL1 is weakly expressed in ovary. UCHL1 is a ubiquitin-protein hydrolase. It is involved both in the processing of ubiquitin precursors and of ubiquitinated proteins. This enzyme is a thiol protease that recognizes and hydrolyzes a peptide bond at the C-terminal glycine of ubiquitin. UCHL1 also binds to free monoubiquitin and may prevent its degradation in lysosomes. The homodimer of UCHL1 may have ATP-independent ubiquitin ligase activity. UCHL1 dysfunction has been associated with neurodegeneration in Parkinson's, Alzheimer's, and Huntington's disease patients. Reduced UCHL1 function may jeopardize the survival of CNS neurons.

References

Wada H., et al., 1998, Biochem. Biophys. Res. Commun. 251:688-92.

Choi J., et al., 2004, J. Biol. Chem. 279:13256-64.

Lombardino,A.2005, et al., J.Proc Natl Acad Sci.USA102 (22):8036-41

Okochi-Takada,E. et al., 2006, Int J Cancer. 119 (6):1338-44.

Zetterberg, M. et al., 2010, Mol Neurodegener 5 :11.

Catalog Number:MGI229-CM