Human UBE2F Gene ORF cDNA clone expression plasmid,N terminal Myc tag

Gene

Species

Human

NCBI Ref Seq

NM_080678.2

RefSeq ORF Size

558bp

Gene Synonym

NCE2

Sequence Description

Identical with the Gene Bank Ref. ID sequence.

Description

Full length Clone DNA of Human ubiquitin-conjugating enzyme E2F (putative) Gene ORF cDNA clone expression plasmid,N terminal Myc tag

Plasmid

Promoter

Enhanced CMV mammalian cell promoter

Vector

pCMV3-N-Myc

Restriction Site

Protein Tag

Myc

Tag Sequence

GAGCAGAAACTCATCTCAGAAGAGGATCTG

Sequencing Primers

Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)

Quality Control

The plasmid is confirmed by full-length sequencing.

Myc Tag Information

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Screening

Antibiotic in E.coli

Kanamycin

Antibiotic in Mammalian cell

Hygromycin

Application

Stable or Transient mammalian expression

Storage & Shipping

Shipping

Each tube contains lyophilized plasmid.

Storage

The lyophilized plasmid can be stored at ambient temperature for three months.

Other Life Science vendor

Natural small molecules manufacturer | Biological Research Reagents Manufacturer

Background Information

UBE2F is a member of the ubiquitin-conjugating E2 family whose members perform the second step in the ubiquitination reaction. Initially identified as the main process for protein degradation, ubiquitination is believed nowadays to be crucial for a wider range of cellular processes. The outcome of the ubiquitin-conjugation reaction, and thereby the fate of the substrate, is heavily dependent on the number of ubiquitin molecules attached and how these ubiquitin molecules are inter-connected. To deal with this complexity and to allow adequate ubiquitination in time and space, a highly sophisticated conjugation machinery has been developed. In a sequential manner, ubiquitin becomes activated by an ubiquitin-activating enzyme (E1), which then transfers the ubiquitin to a group of ubiquitin-conjugating enzymes (E2s). Next, ubiquitin-loaded E2s are interacting with ubiquitin protein ligases (E3s) and ubiquitin is conjugated to substrates on recruitment by the E3. These three key enzymes are operating in a hierarchical system, wherein two E1s and 35 E2s have been found and hundreds of E3s have been identified in humans.

References

Sjoerd J L van Wijk, et al. (2009) A comprehensive framework of E2-RING E3 interactions of the human ubiquitin-proteasome system. Mol Syst Biol. 5: 317.

Nandi D, et al. (2006) The ubiquitin-proteasome system. Journal of biosciences. 31 (1): 137-55.

Catalog Number:MGI205-NM