Mouse TWSG1 Gene ORF cDNA clone expression plasmid,N terminal Flag tag

Gene

Species

Mouse

NCBI Ref Seq

NM_023053.2

RefSeq ORF Size

669bp

Gene Synonym

Tsg, Twg, AW552143, D17Ertd403e, 1810013J15Rik, 9030422N06Rik, Twsg1

Sequence Description

Identical with the Gene Bank Ref. ID sequence.

Description

Full length Clone DNA of Mouse twisted gastrulation homolog 1 (Drosophila) Gene ORF cDNA clone expression plasmid,N terminal Flag tag

Plasmid

Promoter

Enhanced CMV mammalian cell promoter

Vector

pCMV3-N-FLAG

Restriction Site

Protein Tag

Flag

Tag Sequence

GATTACAAGGATGACGACGATAAG

Sequencing Primers

Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)

Quality Control

The plasmid is confirmed by full-length sequencing.

Flag Tag Information

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Screening

Antibiotic in E.coli

Kanamycin

Antibiotic in Mammalian cell

Hygromycin

Application

Stable or Transient mammalian expression

Storage & Shipping

Shipping

Each tube contains lyophilized plasmid.

Storage

The lyophilized plasmid can be stored at ambient temperature for three months.

Other Life Science vendor

Natural small molecules manufacturer | Biological Research Reagents Manufacturer

Background Information

TWSG1 belongs to the twisted gastrulation protein family. TWSG1 from different species are functionally equivalent. In contrast to Drosophila where TWSG1 expression is limited to early embryos, expression of TWSG1 is found throughout mouse and human development. Mutations in the TWSG1 gene cause at least some of the cells on the dorsal half of the embryo to adopt more ventral cell fates. This is thought to involve gradients of the signaling molecule decapentaplegic. TWSG1 may function as a bone morphogenetic protein signalling agonist or antagonize these activities. It can dislodge latent bone morphogenetic proteins and thus provides a permissive signal that allows high BMP signaling in the embryo. TWSG1 is a cofactor in the antagonism of chordin to BMP signaling. It also binds both the vertebrate Decapentaplegic ortholog BMP4 and chordin and forms ternary complexes. Meanwhile, TWSG1 increases binding of chordin to BMP4, potentiates the ability of chordin to induce secondary axes in Xenopus embryos, and enhances chordin cleavage by vertebrate proteases related to tolloid at a site poorly used in the absence of TWSG1. The presence of TWSG1 enhances the secondary axis-inducing activity of 2 products of chordin cleavage.

References

Tzachanis D, et al. (2007) Twisted gastrulation (Tsg) is regulated by Tob and enhances TGF-beta signaling in activated T lymphocytes. J Immunol. Blood. 109 (7): 2944-52.

Tanno T, et al. (2009) Identification of TWSG1 as a second novel erythroid regulator of hepcidin expression in murine and human cells. Blood. 114 (1): 181-6.

Kauvar EF, et al. (2011) Minimal evidence for a direct involvement of twisted gastrulation homolog 1 (TWSG1) gene in human holoprosencephaly. Mol Genet Metab. 102 (4): 470-80.

Catalog Number:MGI165-NF