Rat TSC22D1 Gene ORF cDNA clone expression plasmid,N terminal OFP tag

Catalog Number:MGI079-NO

Gene
Species
Rat
NCBI Ref Seq
RefSeq ORF Size
432bp
Gene Synonym
TS22A, TSC-22, Tgfb1i4
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Rat TSC22 domain family, member 1 Gene ORF cDNA clone expression plasmid,N terminal OFP tag
Plasmid
Promoter
Enhanced CMV mammalian cell promoter
Vector
pCMV3-N-OFPSpark
Restriction Site
Protein Tag
OFPSpark
Tag Sequence
GATAGCACTGAG……CACCTGTTCCAG
Sequencing Primers
Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)
Quality Control
The plasmid is confirmed by full-length sequencing.
OFPSpark Tag Information

OFPSpark is a red (orange) fluorescent protein (excitation/emission maxima are 549 and 566 nm, respectively) derived from DsRed. Possessing high photostability and pH stability, OFPSpark is more than twice brighter than mOrange2. Fast OFPSpark maturation makes it clearly detectable in mammalian cells as early as within 8 hrs after transfection. OFPSpark can be expressed and detected in a wide range of organisms. Mammalian cells transiently transfected with OFPSpark expression vectors produce bright fluorescence in 8 hrs after transfection. No cytotoxic effects or visible protein aggregation are observed. For its monomer structure, OFPSpark performs well in some fusions and protein labeling applications.

Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
Background Information
TSC22 domain family, member 1 (TSC22D1) is one of the TGF-beta-stimulated clone-22 (TSC-22). TSC-22 was reported to be a differentiation-inducing factor which negatively regulates the growth of salivary gland cancer cells. TSC22D1, which encodes transforming growth factor beta-stimulated clone 22 (TSC-22), is thought to be a tumor suppressor because its expression is lost in many glioblastoma, salivary gland, and prostate cancers. TSC-22 is the founding member of the TSC-22/DIP/Bun family of leucine zipper transcription factors. TSC-22 may play an important role in maintaining the differentiated phenotype in salivary gland tumors, and may be a possible target of leukemia therapy. TSC22D1 forms homodimers via its conserved leucine zipper domain and heterodimerizes with TSC22D4. TSC22D1 has transcriptional repressor activity.
References
  • Doi Y, et al. (2008) Expression and cellular localization of TSC-22 in normal salivary glands and salivary gland tumors: implications for tumor cell differentiation. Oncol Rep. 19(3): 609-16.
  • Wu X, et al. (2008) The Drosophila homolog of human tumor suppressor TSC-22 promotes cellular growth, proliferation, and survival. Proc Natl Acad Sci U S A. 105(14): 5414-9.
  • Lu Y, et al. (2007) Identification of TSC-22 as a potential tumor suppressor that is upregulated by Flt3-D835V but not Flt3-ITD. Leukemia. 21(11): 2246-57.
  • TOP