Rhesus Trypsin-3/PRSS3 Gene ORF cDNA clone expression plasmid,C terminal Myc tag

Catalog Number:MGI078-CM

Gene
Species
Rhesus
NCBI Ref Seq
RefSeq ORF Size
744bp
Gene Synonym
PRSS3
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Rhesus protease, serine, 3 Gene ORF cDNA clone expression plasmid,C terminal Myc tag
Plasmid
Promoter
Enhanced CMV mammalian cell promoter
Vector
pCMV3-C-Myc
Restriction Site
Protein Tag
Myc
Tag Sequence
GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)
Quality Control
The plasmid is confirmed by full-length sequencing.
Myc Tag Information

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
Background Information
Trypsin-3, also known as Trypsin III, brain trypsinogen, Serine protease 3 and PRSS3, is a secreted protein which belongs to the peptidase S1 family. Trypsin-3 / PRSS3 is expressed is in pancreas and brain. It contains one peptidase S1 domain. Trypsin-3 / PRSS3 can degrade intrapancreatic trypsin inhibitors that protect against CP. Genetic variants that cause higher mesotrypsin activity might increase the risk for chronic pancreatitis (CP). A sustained imbalance of pancreatic proteases and their inhibitors seems to be important for the development of CP. The trypsin inhibitor-degrading activity qualified PRSS3 as a candidate for a novel CP susceptibility gene. Trypsin-3 / PRSS3 has been implicated as a putative tumor suppressor gene due to its loss of expression, which is correlated with promoter hypermethylation, in esophageal squamous cell carcinoma and gastric adenocarcinoma.
References
  • Venter JC. et al., 2001, Science 291:1304-51.
  • Marsit,CJ. et al., 2005, Mol Carcinog 44 (2):146-50.
  • Rowen, L. et al., 2005, Mol Biol Evol. 22 (8):1712-20.
  • Rosendahl, J. et al., 2010, Pancreatology. 10 (2-3):243-9
  • TOP