Mouse TREML1 Gene ORF cDNA clone expression plasmid,N terminal HA tag

Gene

Species

Mouse

NCBI Ref Seq

NM_001289457.1

RefSeq ORF Size

954bp

Gene Synonym

TLT-1; 5430401J17Rik

Sequence Description

Identical with the Gene Bank Ref. ID sequence.

Description

Full length Clone DNA of Mouse triggering receptor expressed on myeloid cells-like 1 Gene ORF cDNA clone expression plasmid,N terminal HA tag

Plasmid

Promoter

Enhanced CMV mammalian cell promoter

Vector

pCMV3-N-HA

Restriction Site

Protein Tag

HA

Tag Sequence

TATCCTTACGACGTGCCTGACTACGCC

Sequencing Primers

Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)

Quality Control

The plasmid is confirmed by full-length sequencing.

HA Tag Information

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Screening

Antibiotic in E.coli

Kanamycin

Antibiotic in Mammalian cell

Hygromycin

Application

Stable or Transient mammalian expression

Storage & Shipping

Shipping

Each tube contains lyophilized plasmid.

Storage

The lyophilized plasmid can be stored at ambient temperature for three months.

Other Life Science vendor

Natural small molecules manufacturer | Biological Research Reagents Manufacturer

Background Information

Trem-like transcript 1 protein, also known as Triggering receptor expressed on myeloid cells-like protein 1, TREML1 and TLT-1, is a cytoplasm and single-pass type I membrane protein. TREML1 / TLT-1 is expressed exclusively in platelets and megakaryocytes (MKs) and that its expression is up-regulated dramatically upon platelet activation. It is a receptor that may play a role in the innate and adaptive immune response. TREML1 / TLT-1 contains the characteristic single V-set immunoglobulin (Ig) domain, its longer cytoplasmic tail is composed of both a proline-rich region and an immune receptor tyrosine-based inhibitory motif, the latter known to be used for interactions with protein tyrosine phosphatases. The triggering receptors expressed on myeloid cells (TREMs) have drawn considerable attention due to their ability to activate multiple cell types within the innate immune system, including neutrophils, monocyte / macrophages, and dendritic cells, via their association with DAP12. TREML1 / TLT-1 is prepackaged, along with CD62P, into both MK and platelet alpha-granules. Differences in thrombin-induced redistribution of CD62P and TREML1 indicate that TREML1 is not simply cargo of alpha-granules but may instead regulate granule construction or dispersal. TREML1 / TLT-1 does not function to inhibit members of the TREM family but instead may play a role in maintaining vascular hemostasis and regulating coagulation and inflammation at sites of injury.

References

Washington A.V., et al., 2002, Blood 100:3822-4.

Allcock R.J.N., et al., 2003, Eur. J. Immunol. 33:567-77.

Washington A.V., et al., 2004, Blood 104:1042-7.

Barrow A.D., et al., 2004, J. Immunol. 172:5838-42.

Gattis J.L., et al., 2006,J. Biol. Chem. 281:13396-403.

Catalog Number:MGI025-NY