Mouse TREM-2/TREM2 Gene ORF cDNA clone expression plasmid,C terminal HA tag

Gene

Species

Mouse

NCBI Ref Seq

NM_031254.2

RefSeq ORF Size

684bp

Gene Synonym

Trem2a, Trem2b, Trem2c

Sequence Description

Identical with the Gene Bank Ref. ID sequence.

Description

Full length Clone DNA of Mouse triggering receptor expressed on myeloid cells 2 Gene ORF cDNA clone expression plasmid,C terminal HA tag

Plasmid

Promoter

Enhanced CMV mammalian cell promoter

Vector

pCMV3-C-HA

Restriction Site

KpnI + NotI (6kb + 0.72kb)

Protein Tag

HA

Tag Sequence

TATCCTTACGACGTGCCTGACTACGCC

Sequencing Primers

Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)

Quality Control

The plasmid is confirmed by full-length sequencing.

HA Tag Information

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Screening

Antibiotic in E.coli

Kanamycin

Antibiotic in Mammalian cell

Hygromycin

Application

Stable or Transient mammalian expression

Storage & Shipping

Shipping

Each tube contains lyophilized plasmid.

Storage

The lyophilized plasmid can be stored at ambient temperature for three months.

Other Life Science vendor

Natural small molecules manufacturer | Biological Research Reagents Manufacturer

Background Information

Triggering receptor expressed on myeloid cells 2 ( TREM2 ) is a single Ig domain receptor. It is expressed on macrophages and dendritic cells but not on granulocytes or monocytes. Its expression is most abundant in the basal ganglia, corpus callosum, medulla oblongata and spinal cord, and microglial cells are the major TREM2-producing cell type in the central nervous system (CNS). TREM2 may play a role in chronic inflammations and may stimulate production of constitutive rather than inflammatory chemokines and cytokines. TREM2 forms a receptor signaling complex with TYROBP and triggers activation of the immune responses in macrophages and dendritic cells. It also associates with the signal adapter protein, DAP12, which has a cytoplasmic ITAM, leading to the subsequent activation of cytoplasmic tyrosine kinases. TREM2 is both required and sufficient for competent uptake of apoptotic neuronal cells. TREM2 and TREM2-L form a receptor-ligand pair connecting microglia with apoptotic neurons, directing removal of damaged cells to allow repair. Deficiency of the adapter protein DAP12 or its associated receptor TREM2 is associated with abnormal osteoclast development in humans. Defects in TREM2 are causes of PLOSL, also known as NHD. In addition, TREM2 signaling is also an important pathway to promote healing of wounds in the colon where stem cell replacement is necessary.

References

Bouchon, A. et al., 2000, J. Immunol. 164: 4991-4995.

Paloneva, J. et al., 2002, Am. J. Hum. Genet. 71:656-662.

Prada, I. et al., 2006, Neuroscience. 140 (4): 1139-48.

Neumann, H. et al., 2007, J Neuroimmunol. 184 (1-2): 92-9.

Thrash, JC. et al., 2009, Neurochem Res. 34 (1): 38-45.

Catalog Number:MGI024-CY