Mouse TRACP/ACP5 Gene ORF cDNA clone expression plasmid,N terminal HA tag

Gene

Species

Mouse

NCBI Ref Seq

NM_007388.3

RefSeq ORF Size

984bp

Gene Synonym

TRAP, TRACP, Acp5

Sequence Description

Identical with the Gene Bank Ref. ID sequence.

Description

Full length Clone DNA of Mouse acid phosphatase 5, tartrate resistant Gene ORF cDNA clone expression plasmid,N terminal HA tag

Plasmid

Promoter

Enhanced CMV mammalian cell promoter

Vector

pCMV3-N-HA

Restriction Site

Protein Tag

HA

Tag Sequence

TATCCTTACGACGTGCCTGACTACGCC

Sequencing Primers

Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)

Quality Control

The plasmid is confirmed by full-length sequencing.

HA Tag Information

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Screening

Antibiotic in E.coli

Kanamycin

Antibiotic in Mammalian cell

Hygromycin

Application

Stable or Transient mammalian expression

Storage & Shipping

Shipping

Each tube contains lyophilized plasmid.

Storage

The lyophilized plasmid can be stored at ambient temperature for three months.

Other Life Science vendor

Natural small molecules manufacturer | Biological Research Reagents Manufacturer

Background Information

Tartrate-resistant acid phosphatase (TRACP) or acid phosphatase 5, tartrate resistant (ACP5 or TRAP) is a glycosylated monomeric metalloenzyme expressed in mammals. TRACP is associated with osteoblast migration to bone resorption sites, and, once there, TRACP is believed to initiate osteoblast differentiation, activation, and proliferation. TRACP once considered to be just a histochemical marker of osteoclasts is now recognised to be a molecule of widespread occurrence with functions in both the skeleton and the immune system. Two forms of TRACP circulate in human blood, TRACP 5a derived from macrophages and dendritic cells, and TRACP-5b derived from osteoclasts. Recent data have demonstrated the utility of TRACP-5b as a marker of osteoclast number and bone resorption, and serum TRACP-5a as a marker of inflammatory conditions. TRACP is expressed by osteoclasts, macrophages, dendritic cells and a number of other cell types. It has a critical role in many biological processes including skeletal development, collagen synthesis and degradation, the mineralisation of bone, cytokine production by macrophages and dendritic cells, macrophage recruitment, dendritic cell maturation and a role in the development of Th1 responses.

References

Hayman AR. (2008) Tartrate-resistant acid phosphatase (TRAP) and the osteoclast/immune cell dichotomy. Autoimmunity. 41(3): 218-23.

Halleen JM, et al. (2006) Tartrate-resistant acid phosphatase 5b (TRACP 5b) as a marker of bone resorption. Clin Lab. 52(9-10): 499-509.

Mochizuki Y. (2006) Bone and bone related biochemical examinations. Bone and collagen related metabolites. Tartrate-resistant acid phosphatase (TRACP). Clin Calcium. 16(6): 948-55.

Lamp EC, et al. (2000) Biology of tartrate-resistant acid phosphatase. Leuk Lymphoma. 39(5-6): 477-84.

Catalog Number:MGH994-NY