Human TPM1 / Tropomyosin-1 Gene ORF cDNA clone expression plasmid,N terminal Myc tag

Catalog Number:MGH980-NM

Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
855bp
Gene Synonym
CMH3, TMSA, CMD1Y, C15orf13, HTM-alpha
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Human tropomyosin 1 (alpha) Gene ORF cDNA clone expression plasmid,N terminal Myc tag
Plasmid
Promoter
Enhanced CMV mammalian cell promoter
Vector
pCMV3-N-Myc
Restriction Site
Protein Tag
Myc
Tag Sequence
GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)
Quality Control
The plasmid is confirmed by full-length sequencing.
Myc Tag Information

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
Background Information
TPM1, also known as tropomyosin-1, is a member of the tropomyosin family. Members of this family are highly conserved, widely distributed actin-binding proteins involved in the contractile system of striated and smooth muscles and the cytoskeleton of non-muscle cells. highly conserved, widely distributed actin-binding proteins involved in the contractile system of striated and smooth muscles and the cytoskeleton of non-muscle cells. TPM1 is one type of alpha helical chain that forms the predominant tropomyosin of striated muscle. It binds to actin filaments in muscle and non-muscle cells. TPM1 plays a central role, in association with the troponin complex, in the calcium dependent regulation of vertebrate striated muscle contraction.
References
  • Mogensen J. et al., 1999, Cytogenet Cell Genet. 84 (1-2): 35-6.
  • Brown H R. et al., 1985, Proc Natl Acad Sci. 82 (8): 2359-63.
  • Lees-Miller JP. et al., 1992, BioEssays. 13 (9): 429-37.
  • TOP