Rat TNFSF12 Gene ORF cDNA clone expression plasmid,N terminal Myc tag

Gene

Species

Rat

NCBI Ref Seq

NM_001001513.2

RefSeq ORF Size

750bp

Gene Synonym

TWEAK, Prmt2, Tnfsf12

Sequence Description

Identical with the Gene Bank Ref. ID sequence.

Description

Full length Clone DNA of Rat tumor necrosis factor ligand superfamily member 12 Gene ORF cDNA clone expression plasmid,N terminal Myc tag

Plasmid

Promoter

Enhanced CMV mammalian cell promoter

Vector

pCMV3-N-Myc

Restriction Site

Protein Tag

Myc

Tag Sequence

GAGCAGAAACTCATCTCAGAAGAGGATCTG

Sequencing Primers

Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)

Quality Control

The plasmid is confirmed by full-length sequencing.

Myc Tag Information

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Screening

Antibiotic in E.coli

Kanamycin

Antibiotic in Mammalian cell

Hygromycin

Application

Stable or Transient mammalian expression

Storage & Shipping

Shipping

Each tube contains lyophilized plasmid.

Storage

The lyophilized plasmid can be stored at ambient temperature for three months.

Other Life Science vendor

Natural small molecules manufacturer | Biological Research Reagents Manufacturer

Background Information

TNFSF12 is a cytokine that belongs to the tumor necrosis factor (TNF) ligand family. It is a ligand for the FN14/TWEAKR receptor. TNFSF12 has overlapping signaling functions with TNF, but displays a much wider tissue distribution. It can induce apoptosis via multiple pathways of cell death in a cell type-specific manner. It is also found that TNFSF12 promotes proliferation and migration of endothelial cells, and thus acts as a regulator of angiogenesis. TNFSF12 also is a weak inducer of apoptosis in some cell types and mediates NF-kappa-B activation.

References

Wiley SR, et al. (2004) TWEAK, a member of the TNF superfamily, is a multifunctional cytokine that binds the TweakR/Fn14 receptor. Cytokine Growth Factor Rev. 14(3-4):241-9.

Campbell S, et al. (2006) The role of TWEAK/Fn14 in the pathogenesis of inflammation and systemic autoimmunity. Front Biosci. 9:2273-84.

Lynch CN, et al. (1999) TWEAK induces angiogenesis and proliferation of endothelial cells. J Biol Chem. 274(13):8455-9.

Catalog Number:MGH929-NM