Rat TNFRSF19/TROY Gene ORF cDNA clone expression plasmid,C terminal HA tag

Gene

Species

Rat

NCBI Ref Seq

NM_001044229.2

RefSeq ORF Size

1251bp

Gene Synonym

RGD1564996, Tnfrsf19

Sequence Description

Identical with the Gene Bank Ref. ID sequence.

Description

Full length Clone DNA of Rat tumor necrosis factor receptor superfamily, member 19 Gene ORF cDNA clone expression plasmid,C terminal HA tag

Plasmid

Promoter

Enhanced CMV mammalian cell promoter

Vector

pCMV3-C-HA

Restriction Site

Protein Tag

HA

Tag Sequence

TATCCTTACGACGTGCCTGACTACGCC

Sequencing Primers

Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)

Quality Control

The plasmid is confirmed by full-length sequencing.

HA Tag Information

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Screening

Antibiotic in E.coli

Kanamycin

Antibiotic in Mammalian cell

Hygromycin

Application

Stable or Transient mammalian expression

Storage & Shipping

Shipping

Each tube contains lyophilized plasmid.

Storage

The lyophilized plasmid can be stored at ambient temperature for three months.

Other Life Science vendor

Natural small molecules manufacturer | Biological Research Reagents Manufacturer

Background Information

Tumor necrosis factor receptor superfamily, member 19 (TNFRSF19), also known as TAJ-alpha or TROY, is a member of the TNF-receptor superfamily. TNFRSF19/TROY expression is detected in the pulmonary epithelium and the ductal epithelium of the prostate and parotid glands. TNFRSF19/TROY expression is detected in some adenocarcinoma cell lines that arise from this tissue. It has been shown to interact with TRAF family members, and to activate JNK signaling pathway when overexpressed in cells. TNFRSF19/TROY is capable of inducing apoptosis by a caspase-independent mechanism, and it is thought to play an essential role in embryonic development. TNFRSF19/TROY was negatively regulated by adipogenic transcription factor CCAAT/enhancer-binding proteins (C/EBP). TNFRSF19 signals activation of the Jnk pathway and induces cell death. Overexpression of TNFRSF19 also signals NFB activation, comparable and similar to that by p75NGFR. TNFRSF19/TROY is capable of activating key signaling pathways of the TNF receptor family, and its predominant expression patterns suggest that it plays a role in the growth and regulation of epithelial tissues.

References

Hu S, et al. (1999) Characterization of TNFRSF19, a novel member of the tumor necrosis factor receptor superfamily. Genomics. 62(1): 103-7.

Qiu W, et al. (2010) Tumor necrosis factor receptor superfamily member 19 (TNFRSF19) regulates differentiation fate of human mesenchymal (stromal) stem cells through canonical Wnt signaling and C/EBP. J Biol Chem. 285(19): 14438-49.

Hisaoka T, et al. (2006) Characterization of TROY/TNFRSF19/TAJ-expressing cells in the adult mouse forebrain. Brain Res. 1110(1): 81-94.

Catalog Number:MGH926-CY