Mouse TIMP-2/TIMP2 Gene ORF cDNA clone expression plasmid,C terminal Myc tag

Gene

Species

Mouse

NCBI Ref Seq

NM_011594.3

RefSeq ORF Size

663bp

Gene Synonym

Timp-2, D11Bwg1104e, Timp2

Sequence Description

Identical with the Gene Bank Ref. ID sequence.

Description

Full length Clone DNA of Mouse tissue inhibitor of metalloproteinase 2 Gene ORF cDNA clone expression plasmid,C terminal Myc tag

Plasmid

Promoter

Enhanced CMV mammalian cell promoter

Vector

pCMV3-C-Myc

Restriction Site

Protein Tag

Myc

Tag Sequence

GAGCAGAAACTCATCTCAGAAGAGGATCTG

Sequencing Primers

Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)

Quality Control

The plasmid is confirmed by full-length sequencing.

Myc Tag Information

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Screening

Antibiotic in E.coli

Kanamycin

Antibiotic in Mammalian cell

Hygromycin

Application

Stable or Transient mammalian expression

Storage & Shipping

Shipping

Each tube contains lyophilized plasmid.

Storage

The lyophilized plasmid can be stored at ambient temperature for three months.

Other Life Science vendor

Natural small molecules manufacturer | Biological Research Reagents Manufacturer

Background Information

Tissue inhibitors of metalloproteinases (TIMP) family are natural inhibitors of the matrix metalloproteinases (MMPs), the zinc enzymes involved in extracellular matrix maintenance and remodeling. The TIMP family encompasses four members (TIMP1-4), and they inhibit most MMPs by forming non-covalent binary complex. TIMP2 is a 22 kDa non N-glycosylated protein expressed by a variety of cell types, and plays a unique role among TIMP family members owing to its functions to regulate cellular responses to growth factors. Findings establish an unexpected, MMP-independent mechanism for TIMP2 inhibition of endothelial cell proliferation in vitro and reveal an important component of the antiangiogenic effect of TIMP2 in vivo. TIMP-2 thus is critical to the maintenance of tissue homeostasis and is involved in the regulation of tumor microenvironment.

References

Stetler-Stevenson, W.G. et al., 1992, Matrix. Suppl.1: 299-306.

Stetler-Stevenson, W.G. et al., 2005, Trends. Mol. Med. 11: 97-103.

Seo, D.W. et al., 2003, Cell. 114: 171-180.

Catalog Number:MGH746-CM