Mouse TIGIT/VSTM3 Gene ORF cDNA clone expression plasmid,C terminal Flag tag

Catalog Number:MGH730-CF

Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
726bp
Gene Synonym
Vstm3, ENSMUSG00000071552, Tigit
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Mouse T cell immunoreceptor with Ig and ITIM domains Gene ORF cDNA clone expression plasmid,C terminal Flag tag
Plasmid
Promoter
Enhanced CMV mammalian cell promoter
Vector
pCMV3-C-FLAG
Restriction Site
Protein Tag
Flag
Tag Sequence
GATTACAAGGATGACGACGATAAG
Sequencing Primers
Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)
Quality Control
The plasmid is confirmed by full-length sequencing.
Flag Tag Information

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
Background Information
TIGIT, also known as V-set and transmembrane domain-containing protein 3 (VSTM3) or V-set and immunoglobulin domain-containing protein 9 (VSIG9) is a new surface protein containing an immunoglobulin variable domain, a transmembrane domain and an immunoreceptor tyrosine-based inhibitory motif (ITIM). TIGIT is expressed on regulatory, memory, activated T cells and NK cells. It binds PVR with high affinity, and PVRL2 with lower affinity, but not PVRL3. Knockdown of TIGIT with siRNA in human memory T cells did not affect T cell responses, however, TIGIT inhibits NK cytotoxicity directly through its ITIM. TIGIT suppresses T cell activation by promoting the generation of mature immunoregulatory dendritic cells. The binding of PVR to TIGIT on human dendritic cells enhanced the production of IL-10 and diminished the production of IL-12p40. In addition, TIGIT counter inhibits the NK-mediated killing of tumor cells and protects normal cells from NK-mediated cytotoxicity thus providing an "alternative self" mechanism for MHC class I inhibition.
References
TOP