Rat Tie2/CD202b/TEK Gene ORF cDNA clone expression plasmid,N terminal Flag tag

Gene

Species

Rat

NCBI Ref Seq

NM_001105737.1

RefSeq ORF Size

3363bp

Gene Synonym

Tie2, Tie-2, Tek

Sequence Description

Identical with the Gene Bank Ref. ID sequence.

Description

Full length Clone DNA of Rat TEK tyrosine kinase, endothelial Gene ORF cDNA clone expression plasmid,N terminal Flag tag

Plasmid

Promoter

Enhanced CMV mammalian cell promoter

Vector

pCMV3-N-FLAG

Restriction Site

Protein Tag

Flag

Tag Sequence

GATTACAAGGATGACGACGATAAG

Sequencing Primers

Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)

Quality Control

The plasmid is confirmed by full-length sequencing.

Flag Tag Information

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Screening

Antibiotic in E.coli

Kanamycin

Antibiotic in Mammalian cell

Hygromycin

Application

Stable or Transient mammalian expression

Storage & Shipping

Shipping

Each tube contains lyophilized plasmid.

Storage

The lyophilized plasmid can be stored at ambient temperature for three months.

Other Life Science vendor

Natural small molecules manufacturer | Biological Research Reagents Manufacturer

Background Information

TEK, or TIE-2, is an endothelial cell-specific receptor tyrosine kinase (RTK) that is known as a functioning molecule of vascular endothelial cells. TEK comprises a subfamily of RTK with TIE, and these two receptors play critical roles in vascular maturation, maintenance of integrity and remodeling. Targeted mutagenesis of both Tek and its agonistic ligand, Angiopoietin-1, result in embryonic lethality, demonstrating that the signal transduction pathways mediated by this receptor are crucial for normal embryonic development. TEK signaling is indispensable for the development of the embryonic vasculature and suggests that TEK signaling may also be required for the development of the tumor vasculature.

References

Jones N, et al. (1998) The Tek / Tie2 receptor signals through a novel Dok-related docking protein, Dok-R. Oncogene. 17(9): 1097-108.

Sato A, et al. (1998) Characterization of TEK receptor tyrosine kinase and its ligands, Angiopoietins, in human hematopoietic progenitor cells. Int Immunol. 10(8): 1217-27.

Huang L, et al. (1995) GRB2 and SH-PTP2: potentially important endothelial signaling molecules downstream of the TEK / TIE2 receptor tyrosine kinase. Oncogene. 11(10): 2097-103.

Catalog Number:MGH728-NF