Mouse THSD1 Gene ORF cDNA clone expression plasmid,N terminal Myc tag

Catalog Number:MGH716-NM

Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
2556bp
Gene Synonym
Tmtsp, AW121720, 4833423O18Rik, Thsd1
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Mouse thrombospondin, type I , domain 1 Gene ORF cDNA clone expression plasmid,N terminal Myc tag
Plasmid
Promoter
Enhanced CMV mammalian cell promoter
Vector
pCMV3-N-Myc
Restriction Site
Protein Tag
Myc
Tag Sequence
GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)
Quality Control
The plasmid is confirmed by full-length sequencing.
Myc Tag Information

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
Background Information
Thrombospondin type-1 domain-containing protein 1, also known as transmembrane molecule with thrombospondin module, THSD1 and TMTSP, is a single-pass type I membrane protein which contains one TSP type-1 domain. THSD1 is a multi-domain, multi-functional glycoprotein synthesized by many cells. Matricellular THSD1 modulates cell adhesion and proliferation. It is involved in angiogenesis, inflammation, wound healing and cancer. In vitro, nanomolar concentrations of Thrombospondin-1 are required to alter endothelial and vascular smooth muscle cell adhesion, proliferation, motility, and survival. As a major platelet protein, for a long time it was postulated to control hemostasis via platelet aggregate stabilization. THSD1 is a potent angiogenesis inhibitor, and down-regulation of THSD1 has been suggested to alter tumor growth by modulating angiogenesis in a variety of tumor types.
References
  • Lawler J. (2002) Thrombospondin-1 as an endogenous inhibitor of angiogenesis and tumor growth. J Cell Mol Med. 6(1): 1-12.
  • Ren B, et al. (2006) Regulation of tumor angiogenesis by thrombospondin-1. Biochim Biophys Acta. 1765(2): 178-88.
  • Mirochnik Y, et al. (2008) Thrombospondin and apoptosis: molecular mechanisms and use for design of complementation treatments. Curr Drug Targets. 9(10): 851-62.
  • Bonnefoy A, et al. (2008) The evolving role of thrombospondin-1 in hemostasis and vascular biology. Cell Mol Life Sci. 65(5): 713-27.
  • Isenberg JS, et al. (2008) Thrombospondin-1: a physiological regulator of nitric oxide signaling. Cell Mol Life Sci. 65(5): 728-42.
  • TOP