Mouse THOP1 Gene ORF cDNA clone expression plasmid,C terminal Myc tag

Gene

Species

Mouse

NCBI Ref Seq

NM_022653.4

RefSeq ORF Size

2064bp

Gene Synonym

EP24.15, AI131655, AI327041, Thop1

Sequence Description

Identical with the Gene Bank Ref. ID sequence.

Description

Full length Clone DNA of Mouse thimet oligopeptidase 1 Gene ORF cDNA clone expression plasmid,C terminal Myc tag

Plasmid

Promoter

Enhanced CMV mammalian cell promoter

Vector

pCMV3-C-Myc

Restriction Site

Protein Tag

Myc

Tag Sequence

GAGCAGAAACTCATCTCAGAAGAGGATCTG

Sequencing Primers

Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)

Quality Control

The plasmid is confirmed by full-length sequencing.

Myc Tag Information

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Screening

Antibiotic in E.coli

Kanamycin

Antibiotic in Mammalian cell

Hygromycin

Application

Stable or Transient mammalian expression

Storage & Shipping

Shipping

Each tube contains lyophilized plasmid.

Storage

The lyophilized plasmid can be stored at ambient temperature for three months.

Other Life Science vendor

Natural small molecules manufacturer | Biological Research Reagents Manufacturer

Background Information

THOP1, also known as Thimet oligopeptidase 1, Thimet oligopeptidase, EC 3.4.24.15, or EP24.15, is a zinc(II) endopeptidase implicated in the processing of numerous physiological peptides. As an intracellular enzyme, highly expressed in the brain, kidneys and neuroendocrine tissue, THOP1 has been proposed to metabolize peptides within cells, thereby affecting antigen presentation and G protein-coupled receptor signal transduction. Its substrates is gonadotrophin-releasing hormone (GnRH), an important hypothalamic hormone that regulates the synthesis and release of oestradiol and facilitates female sexual behaviour. THOP1 against toxic effects of Abeta in the early stages of Alzheimer disease (AD) pathology, and suggest that the observed increase in THOP1 expression might be part of a compensatory defense mechanism of the brain against an increased Abeta load.

References

Cyr NE, et al. (2010) Nuclear Thimet oligopeptidase is coexpressed with oestrogen receptor alpha in hypothalamic cells and regulated by oestradiol in female mice. J Neuroendocrinol. 22(8): 936-43.

Berti DA, et al. (2009) Analysis of intracellular substrates and products of thimet oligopeptidase in human embryonic kidney 293 cells. J Biol Chem. 284(21): 14105-16.

Russo LC, et al. (2009) Interaction with calmodulin is important for the secretion of thimet oligopeptidase following stimulation. FEBS J. 276(16): 4358-71.

Pollio G, et al. (2008) Increased expression of the oligopeptidase THOP1 is a neuroprotective response to Abeta toxicity. Neurobiol Dis. 31(1): 145-58.

Bruce LA, et al. (2008) Hydrogen bond residue positioning in the 599-611 loop of thimet oligopeptidase is required for substrate selection. FEBS J. 275(22): 5607-17.

Catalog Number:MGH709-CM