Rat TGF-beta 1/TGFB1 Gene ORF cDNA clone expression plasmid,N terminal GFP tag

Catalog Number:MGH679-NG

Gene
Species
Rat
NCBI Ref Seq
RefSeq ORF Size
1179 bp
Gene Synonym
Tgfb1
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Rat transforming growth factor, beta 1 Gene ORF cDNA clone expression plasmid,N terminal GFP tag
Plasmid
Promoter
Enhanced CMV mammalian cell promoter
Vector
pCMV3-N-GFPSpark
Restriction Site
HindIII + XbaI(6kb+1.18kb)
Protein Tag
GFPSpark
Tag Sequence
GTGAGCAAGGGC……GAGCTGTACAAG
Sequencing Primers
Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)
Quality Control
The plasmid is confirmed by full-length sequencing.
GFPSpark Tag Information
GFPSpark is an improved variant of the green fluorescent protein GFP. It possesses bright green fluorescence (excitation/ emission max = 487 / 508 nm) that is visible earlier than fluorescence of other green fluorescent proteins. GFPSpark is mainly intended for applications where fast appearance of bright fluorescence is crucial. It is specially recommended for cell and organelle labeling and tracking the promoter activity.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
Background Information
TGF-beta 1 is a member of the transforming growth factor beta (TGF-beta) family. The transforming growth factor-beta family of polypeptides are involved in the regulation of cellular processes, including cell division, differentiation, motility, adhesion and death. TGF-beta 1 positively and negatively regulates many other growth factors. It inhibits the secretion and activity of many other cytokines including interferon-γ, tumor necrosis factor-alpha and various interleukins. It can also decrease the expression levels of cytokine receptors. Meanwhile, TGF-beta 1 also increases the expression of certain cytokines in T cells and promotes their proliferation, particularly if the cells are immature. TGF-beta 1 also inhibits proliferation and stimulates apoptosis of B cells, and plays a role in controlling the expression of antibody, transferrin and MHC class II proteins on immature and mature B cells. As for myeloid cells, TGF-beta 1can inhibit their proliferation and prevent their production of reactive oxygen and nitrogen intermediates. However, as with other cell types, TGF-beta 1 also has the opposite effect on cells of myeloid origin. TGF-beta 1 is a multifunctional protein that controls proliferation, differentiation and other functions in many cell types. It plays an important role in bone remodeling as it is a potent stimulator of osteoblastic bone formation, causing chemotaxis, proliferation and differentiation in committed osteoblasts. Once cells lose their sensitivity to TGF-beta1-mediated growth inhibition, autocrine TGF-beta signaling can promote tumorigenesis. Elevated levels of TGF-beta1 are often observed in advanced carcinomas, and have been correlated with increased tumor invasiveness and disease progression.
References
  • Ghadami M, et al. (2000) Genetic Mapping of the Camurati-Engelmann Disease Locus to Chromosome 19q13.1-q13.3. Am J Hum. Genet. 66(1):143-7.
  • Letterio J, et al. (1998) Regulation of immune responses by TGF-beta. Annu Rev Immunol. 16:137-61.
  • Vaughn SP, et al. (2000) Confirmation of the mapping of the Camurati-Englemann locus to 19q13. 2 and refinement to a 3.2-cM region. Genomics. 66(1):119-21.
  • Assoian R, et al. (1983) Transforming growth factor-beta in human platelets. Identification of a major storage site, purification, and characterization. J Biol Chem. 258(11):7155-60.
  • TOP