Rat TFRC/CD71 Gene ORF cDNA clone expression plasmid,C terminal Myc tag

Catalog Number:MGH678-CM

Gene
Species
Rat
NCBI Ref Seq
RefSeq ORF Size
2286bp
Gene Synonym
Trfr, Tfrc
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Rat transferrin receptor Gene ORF cDNA clone expression plasmid,C terminal Myc tag
Plasmid
Promoter
Enhanced CMV mammalian cell promoter
Vector
pCMV3-C-Myc
Restriction Site
KpnI(two restriction sites) + NotI (5.99kb + 1.5kb + 0.88kb)
Protein Tag
Myc
Tag Sequence
GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)
Quality Control
The plasmid is confirmed by full-length sequencing.
Myc Tag Information

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
Background Information
Transferrin receptor protein 1, also known as transferrin receptor, Trfr, p90, CD71 and TFRC, is a single-pass type II membrane protein which belongs to the peptidase M28 family and M28B subfamily. TFRC / CD71 is a membrane-bound protein expressed in larger amounts in proliferating. The specific expression of TFRC can represent a diagnostic tool or a therapeutic target in solid tumours expressing this antigen. Transferrin receptor is necessary for development of erythrocytes and the nervous system. TFRC / CD71 is regulated by cellular iron levels through binding of the iron regulatory proteins, IRP1 and IRP2, to iron-responsive elements in the 3'-UTR. Up-regulated upon mitogenic stimulation. TFRC / CD71 represents a marker of malignant transformation in the pancreas that could be applied as potential diagnostic and therapeutic target.
References
  • Douabin-Gicquel V., et al., 2001,Hum. Genet. 109:393-401.
  • Ryschich,E. et al., 2004,Eur J Cancer. 40 (9):1418-22.
  • Tosoni D., et al., 2005, Cell 123:875-888.
  • Wollscheid B., et al., 2009, Nat. Biotechnol. 27:378-386.
  • TOP