Mouse TFPI Gene ORF cDNA clone expression plasmid,N terminal HA tag

Gene

Species

Mouse

NCBI Ref Seq

NM_011576.1

RefSeq ORF Size

921bp

Gene Synonym

EPI, LACI, AW552122, A630013F22Rik

Sequence Description

Identical with the Gene Bank Ref. ID sequence.

Description

Full length Clone DNA of Mouse tissue factor pathway inhibitor Gene ORF cDNA clone expression plasmid,N terminal HA tag

Plasmid

Promoter

Enhanced CMV mammalian cell promoter

Vector

pCMV3-N-HA

Restriction Site

Protein Tag

HA

Tag Sequence

TATCCTTACGACGTGCCTGACTACGCC

Sequencing Primers

Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)

Quality Control

The plasmid is confirmed by full-length sequencing.

HA Tag Information

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Screening

Antibiotic in E.coli

Kanamycin

Antibiotic in Mammalian cell

Hygromycin

Application

Stable or Transient mammalian expression

Storage & Shipping

Shipping

Each tube contains lyophilized plasmid.

Storage

The lyophilized plasmid can be stored at ambient temperature for three months.

Other Life Science vendor

Natural small molecules manufacturer | Biological Research Reagents Manufacturer

Background Information

Tissue factor pathway inhibitor (TFPI) is the natural inhibitor of TF coagulant and signaling activities. It is a Kunitz-type serine proteinase inhibitor that down-regulates tissue factor-initiated blood coagulation. With its Kunitz domains, TFPI exhibits significant homology with human inter-alpha-trypson inhibitor and bovin basic pancreatic trypsin inhibitor. TFPI is the natural inhibitor of TF coagulant and signaling activities. The importance of TFPI in the regulation of blood coagulation is emphasized by how its activity is modulated in human disease. In a factor (F) Xa-dependent feedback system, TFPI binds directly and inhibits the TF-FVII/FVIIa complex. Normally, TFPI exists in plasma both as a full-length molecule and as variably carboxy-terminal truncated forms. TFPI also circulates in complex with plasma lipoproteins. The levels and the dual inhibitor effect of TFPI on FXa and TF-FVII/FVIIa complex offers insight into the mechanisms of various pathological conditions triggered by TF. TFPI may play an important role in modulating TF-induced thrombogenesis and it may also provide a unique therapeutic approach for prophylaxis and/or treatment of various diseases. In addition, Studies have shown that TFPI exhibits antiangiogenic and antimetastatic effects in vitro and in vivo. In animal models of experimental metastasis, both circulating and tumor cell-associated TFPI are shown to significantly reduce tumor cell-induced coagulation activation and lung metastasis.

References

Lwaleed BA, et al. (2006) Tissue factor pathway inhibitor: structure, biology and involvement in disease. J Pathol. 208(3): 327-39.

Amirkhosravi A, et al. (2007) The role of tissue factor pathway inhibitor in tumor growth and metastasis. Semin Thromb Hemost. 33(7): 643-52.

Maroney SA, et al. (2008) Expression of tissue factor pathway inhibitor by endothelial cells and platelets. Transfus Apher Sci. 38(1): 9-14.

Catalog Number:MGH674-NY