Mouse STAT1 Gene ORF cDNA clone expression plasmid,C terminal GFP tag

Catalog Number:MGH451-CG

Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
2250bp
Gene Synonym
AA408197; 2010005J02Rik
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Mouse signal transducer and activator of transcription 1 Gene ORF cDNA clone expression plasmid,C terminal GFP tag
Plasmid
Promoter
Enhanced CMV mammalian cell promoter
Vector
pCMV3-C-GFPSpark
Restriction Site
Protein Tag
GFPSpark
Tag Sequence
GTGAGCAAGGGC……GAGCTGTACAAG
Sequencing Primers
Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)
Quality Control
The plasmid is confirmed by full-length sequencing.
GFPSpark Tag Information
GFPSpark is an improved variant of the green fluorescent protein GFP. It possesses bright green fluorescence (excitation/ emission max = 487 / 508 nm) that is visible earlier than fluorescence of other green fluorescent proteins. GFPSpark is mainly intended for applications where fast appearance of bright fluorescence is crucial. It is specially recommended for cell and organelle labeling and tracking the promoter activity.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
Background Information
STAT1 is a member of the STAT protein family. In response to cytokines and growth factors, STAT family members are phosphorylated by the receptor associated kinases, and then form homo- or heterodimers that translocate to the cell nucleus where they act as transcription activators. STAT1 can be activated by various ligands, including interferon-alpha, interferon-gamma, EGF, PDGF and IL6. It is a signal transducer and transcription activator that mediates cellular responses to interferons (IFNs), cytokine KITLG/SCF and other cytokines and growth factors. The phosphorylated STATs dimerize, associate with ISGF3G/IRF-9 to form a complex termed ISGF3 transcription factor, that enters the nucleus. ISGF3 binds to the IFN stimulated response element (ISRE) to activate the transcription of interferon stimulated genes, which drive the cell in an antiviral state. In response to type II IFN (IFN-gamma), STAT1 is tyrosine- and serine-phosphorylated. It then forms a homodimer termed IFN-gamma-activated factor (GAF), migrates into the nucleus and binds to the IFN gamma activated sequence (GAS) to drive the expression of the target genes, inducing a cellular antiviral state. STAT1 becomes activated in response to KITLG/SCF and KIT signaling and may mediate cellular responses to activated FGFR1, FGFR2, FGFR3 and FGFR4. Defects in STAT1 can cause STAT1 deficiency complete and familial candidiasis type 7.
References
  • Shah S, et al. (2011) A novel disrupter of telomere silencing 1-like (DOT1L) interaction is required for signal transducer and activator of transcription 1 (STAT1)-activated gene expression. J Biol Chem. 286(48):41195-204.
  • Barthson J, et al. (2011) Cytokines tumor necrosis factor- and interferon-gamma induce pancreatic beta-cell apoptosis through STAT1-mediated Bim protein activation. J Biol Chem. 286(45):39632-43.
  • Xin Z, et al. (2011) PCBP2 enhances the antiviral activity of IFN- against HCV by stabilizing the mRNA of STAT1 and STAT2. PLoS One. 6(10):e25419.
  • Perwitasari O, et al. (2011) Inhibitor of B kinase epsilon (IKK(epsilon)), STAT1, and IFIT2 proteins define novel innate immune effector pathway against West Nile virus infection. J Biol Chem. 286(52):44412-23.
  • TOP