Human SRFBP1 (p49/STRAP) Gene ORF cDNA clone expression plasmid,C terminal HA tag

Gene

Species

Human

NCBI Ref Seq

BC031222

RefSeq ORF Size

1290bp

Gene Synonym

P49, Rlb1, BUD22, STRAP, p49/STRAP

Sequence Description

Identical with the Gene Bank Ref. ID sequence.

Description

Full length Clone DNA of Human serum response factor binding protein 1 Gene ORF cDNA clone expression plasmid,C terminal HA tag

Plasmid

Promoter

Enhanced CMV mammalian cell promoter

Vector

pCMV3-C-HA

Restriction Site

Protein Tag

HA

Tag Sequence

TATCCTTACGACGTGCCTGACTACGCC

Sequencing Primers

Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)

Quality Control

The plasmid is confirmed by full-length sequencing.

HA Tag Information

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Screening

Antibiotic in E.coli

Kanamycin

Antibiotic in Mammalian cell

Hygromycin

Application

Stable or Transient mammalian expression

Storage & Shipping

Shipping

Each tube contains lyophilized plasmid.

Storage

The lyophilized plasmid can be stored at ambient temperature for three months.

Other Life Science vendor

Natural small molecules manufacturer | Biological Research Reagents Manufacturer

Background Information

SRFBP1 contains 7 WD repeats and belongs to the WD repeat STRAP family. SRFBP1 may play a role in the cellular distribution of the SMN complex. The SMN complex plays an essential role in spliceosomal snRNP assembly in the cytoplasm and is required for pre-mRNA splicing in the nucleus. SRFBP1 negatively regulates TGF-beta signaling but positively regulates the PDPK1 kinase activity by enhancing its autophosphorylation and by significantly reducing the association of PDPK1 with 14-3-3 protein. SRFBP1 may be involved in regulating transcriptional activation of cardiac genes during the aging process. It also may play a role in biosynthesis and/or processing of SLC2A4 in adipose cells.

References

Datta PK, et al. (1999) Identification of STRAP, a novel WD domain protein in transforming growth factor-beta signaling. J Biol Chem. 273(52):34671-4.

Datta PK, et al. (1998) Identification of STRAP, a novel WD domain protein in transforming growth factor-beta signaling. J Biol Chem. 273(52):34671-4.

Datta PK, et al. (2000) STRAP and Smad7 synergize in the inhibition of transforming growth factor beta signaling. Mol Cell Biol. 20(9):3157-67.

Catalog Number:MGH385-CY