Mouse SPINK4 Gene ORF cDNA clone expression plasmid,C terminal Flag tag

Catalog Number:MGH353-CF

Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
261bp
Gene Synonym
MPGC60, Spink4
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Mouse serine peptidase inhibitor, Kazal type 4 Gene ORF cDNA clone expression plasmid,C terminal Flag tag
Plasmid
Promoter
Enhanced CMV mammalian cell promoter
Vector
pCMV3-C-FLAG
Restriction Site
Protein Tag
Flag
Tag Sequence
GATTACAAGGATGACGACGATAAG
Sequencing Primers
Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)
Quality Control
The plasmid is confirmed by full-length sequencing.
Flag Tag Information

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
Background Information
Serine protease inhibitor Kazal-type 4, also known as Peptide PEC-60 homolog and SPINK4, is a secreted protein which contains one Kazal-like domain. SPINK4 is a member of the SPINK protein family. The gene family of serine protease inhibitors of the Kazal type (SPINK) are functional and positional candidate genes for celiac disease (CD). SPINK1 plays an important role in protecting the pancreas against excessive trypsinogen activation. It is a potent natural inhibitor of pancreatic trypsin activity. SPINK1 mutations are associated with the development of acute and chronic pancreatitis and have been detected in all forms of chronic pancreatitis. SPINK2 functions as a trypsin/acrosin inhibitor and is synthesized mainly in the testis and seminal vesicle where its activity is engaged in fertility. The SPINK2 protein contains a typical Kazal domain composed by six cysteine residues forming three disulfide bridges. SPINK9 was identified in human skin. Its expression was strong in palmar epidermis, but not detectable or very low in non palmoplantar skin.
References
  • Schneider, A. et al., 2004,Gastroenterol Clin North Am. 33 (4): 789-806.
  • Wapenaar, MC. et al., 2007, Immunogenetics. 59 (5): 349-57.
  • Brattsand, M. et al., 2009, J Invest Dermatol. 129 (7): 1656-65.
  • Chen, T. et al., 2009, Proteins. 77 (1): 209-19.
  • Noah, TK. et al., 2010, Exp Cell Res. 316 (3): 452-65.
  • TOP