Mouse SPG3A/ATL1 Gene ORF cDNA clone expression plasmid,C terminal Flag tag

Catalog Number:MGH344-CF

Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
1677bp
Gene Synonym
Fsp1, Spg3, Adfsp, Spg3a, 4930435M24Rik, Atl1
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Mouse atlastin GTPase 1 Gene ORF cDNA clone expression plasmid,C terminal Flag tag
Plasmid
Promoter
Enhanced CMV mammalian cell promoter
Vector
pCMV3-C-FLAG
Restriction Site
Protein Tag
Flag
Tag Sequence
GATTACAAGGATGACGACGATAAG
Sequencing Primers
Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)
Quality Control
The plasmid is confirmed by full-length sequencing.
Flag Tag Information

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
Background Information
Atlastin-1, also known as Spastic paraplegia 3 protein A, Guanine nucleotide-binding protein 3, GTP-binding protein 3, GBP3, ATL1 and SPG3A, is a multi-pass membrane protein which belongs to the GBP family and atlastin subfamily. ATL1 / SPG3A is expressed predominantly in the adult and fetal central nervous system. Expression of ATL1 / SPG3A in adult brain is at least 50-fold higher than in other tissues. ATL1 / SPG3A is detected predominantly in pyramidal neurons in the cerebral cortex and the hippocampus of the brain. ATL1 / SPG3A is also expressed in upper and lower motor neurons (at protein level). A distinguishing feature of ATL1 / SPG3A is its frequent early onset, raising the possibility that developmental abnormalities may be involved in its pathogenesis. Missense SPG3A mutant atlastin-1 proteins have impaired GTPase activity and may act in a dominant-negative, loss-of-function manner by forming mixed oligomers with wild-type atlastin-1. Defects in ATL1 / SPG3A are the cause of spastic paraplegia autosomal dominant type 3 (SPG3), also known as Strumpell-Lorrain syndrome. Spastic paraplegia is a degenerative spinal cord disorder characterized by a slow, gradual, progressive weakness and spasticity of the lower limbs.
References
TOP