Mouse SLITRK1 Gene ORF cDNA clone expression plasmid,C terminal OFP tag

Catalog Number:MGH200-CO

Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
2091bp
Gene Synonym
3200001I04Rik, Slitrk1
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Mouse SLIT and NTRK-like family, member 1 Gene ORF cDNA clone expression plasmid,C terminal OFP tag
Plasmid
Promoter
Enhanced CMV mammalian cell promoter
Vector
pCMV3-C-OFPSpark
Restriction Site
Protein Tag
OFPSpark
Tag Sequence
GATAGCACTGAG……CACCTGTTCCAG
Sequencing Primers
Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)
Quality Control
The plasmid is confirmed by full-length sequencing.
OFPSpark Tag Information

OFPSpark is a red (orange) fluorescent protein (excitation/emission maxima are 549 and 566 nm, respectively) derived from DsRed. Possessing high photostability and pH stability, OFPSpark is more than twice brighter than mOrange2. Fast OFPSpark maturation makes it clearly detectable in mammalian cells as early as within 8 hrs after transfection. OFPSpark can be expressed and detected in a wide range of organisms. Mammalian cells transiently transfected with OFPSpark expression vectors produce bright fluorescence in 8 hrs after transfection. No cytotoxic effects or visible protein aggregation are observed. For its monomer structure, OFPSpark performs well in some fusions and protein labeling applications.

Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
Background Information
SLITRK1 (Slit and Trk-like family member 1) is a integral membrane protein belonging to the SLITRK family consists of at least 6 members (SLITRK1-6). They are named and characterized by the presence of two leucine-rich repeats (LRRs) in the extracellular domain similar to those found in a secreted axonal growth-controlling protein, Slit, as well as a C-terminal domain with homology to Trk neurotrophin tyrosine kinase receptors. Expression of SLITRKs are highly restricted to neural tissues, and are identified as the neuronal components modulating the neurite outgrowth. More specifically, SLITRK1 expression is found in the mature neurons of the cerebrum, thalamus and hippocampus, and induces unipolar neurites in cultured neuronal cells. Human SLITRK1 is a 696 amino acid precursor protein, and one truncating frameshift mutation (448 aa) has been linked to Tourette's syndrome, a genetically influenced developmental neuropsychiatric disorder characterized by chronic vocal and motor tics. In addition, all SLITRK genes are differentially expressed in brain tumors, such as astrocytoma, oligodendroglioma, glioblastoma, and are suggested to be useful molecular indicators of brain tumor properties.
References

1. Aruga, J. and Mikoshiba, K. 2003, Mol. Cell. Neurosci. 24: 117-129.

2. Aruga, J. et al., 2003, Gene. 315: 87-94.

3. Abelson, J.F. et al., 2005, Science. 310: 317-320.

4. Grados, M.A. and Walkup. J.T. 2006, Trends. Genet. 22: 291-293.

TOP