Mouse SIRPB1A Gene ORF cDNA clone expression plasmid,N terminal OFP tag

Catalog Number:MGH062-NO

Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
1176bp
Gene Synonym
Sirpb, Sirpb1, SIRP-beta, 9930027N05Rik, Sirpb1a
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Mouse signal-regulatory protein beta 1A Gene ORF cDNA clone expression plasmid,N terminal OFP tag
Plasmid
Promoter
Enhanced CMV mammalian cell promoter
Vector
pCMV3-N-OFPSpark
Restriction Site
Protein Tag
OFPSpark
Tag Sequence
GATAGCACTGAG……CACCTGTTCCAG
Sequencing Primers
Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)
Quality Control
The plasmid is confirmed by full-length sequencing.
OFPSpark Tag Information

OFPSpark is a red (orange) fluorescent protein (excitation/emission maxima are 549 and 566 nm, respectively) derived from DsRed. Possessing high photostability and pH stability, OFPSpark is more than twice brighter than mOrange2. Fast OFPSpark maturation makes it clearly detectable in mammalian cells as early as within 8 hrs after transfection. OFPSpark can be expressed and detected in a wide range of organisms. Mammalian cells transiently transfected with OFPSpark expression vectors produce bright fluorescence in 8 hrs after transfection. No cytotoxic effects or visible protein aggregation are observed. For its monomer structure, OFPSpark performs well in some fusions and protein labeling applications.

Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
Background Information
SIRPB1A (Signal-regulatory protein beta 1A), also known as SIRP beta 1, belongs to signal-regulatory-protein (SIRP) family, and immunoglobulin superfamily. Signal-regulatory proteins (SIRPs) are cell-surface glycoproteins expressed on myeloid and neural cells that have been shown to recruit SH2 domain-containing protein phosphatase 1 (SHP-1) and SHP-2 and to regulate receptor tyrosine kinase-coupled signaling. SIRP are classified as SIRP alpha molecules, containing a 110- to 113-amino acid long, or SIRP beta molecules, with a 5-amino acid long intracytoplasmic domain. SIRP beta 1 is a new DAP12-associated receptor involved in the activation of myeloid cells, which contains a short cytoplasmic domain that lacks sequence motifs capable of recruiting SHP-1 and SHP-2. SIRP beta 1. SIRP beta 1 acts as an activating isoform of SIRP alpha molecules, confirming the co-existence of inhibitory ITIM-bearing molecules, recruiting SHP-1 and SHP-2 protein tyrosine phosphatases, and activating counterparts, whose engagement couples to protein tyrosine kinases via ITAM-bearing molecules.
References
  • Gaikwad S, et al. (2009) Signal regulatory protein-beta1: a microglial modulator of phagocytosis in Alzheimer's disease. Am J Pathol. 175(6): 2528-39.
  • Dietrich J, et al. (2000) Cutting edge: signal-regulatory protein beta 1 is a DAP12-associated activating receptor expressed in myeloid cells. J Immunol. 164(1): 9-12.
  • Tomasello E, et al. (2000) Association of signal-regulatory proteins beta with KARAP/DAP-12. Eur J Immunol. 30(8): 2147-56.
  • TOP