Mouse SHP2 / PTPN11 transcript variant 2 Gene ORF cDNA clone expression plasmid,C terminal HA tag

Catalog Number:MGH039-CY

Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
1782bp
Gene Synonym
Syp, Shp2, PTP1D, PTP2C, SAP-2, SHP-2, SH-PTP2, SH-PTP3
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Mouse protein tyrosine phosphatase, non-receptor type 11, transcript variant 2 Gene ORF cDNA clone expression plasmid,C terminal HA tag
Plasmid
Promoter
Enhanced CMV mammalian cell promoter
Vector
pCMV3-C-HA
Restriction Site
Protein Tag
HA
Tag Sequence
TATCCTTACGACGTGCCTGACTACGCC
Sequencing Primers
Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)
Quality Control
The plasmid is confirmed by full-length sequencing.
HA Tag Information

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
Background Information
SHP2, also known as PTPN11, belongs to the protein-tyrosine phosphatase(PTP) family, non-receptor class 2 subfamily. PTPs catalyze the removal of phosphate groups from tyrosine residues by the hydrolysis of phosphoric acid monoesters. They dephosphorylate EGFR, JAK2 and TYK2 kinases, promoting oncogenic transformation. SHP2 is widely expressed, with highest levels in heart, brain, and skeletal muscle. SHP2 acts downstream of various receptor and cytoplasmic protein tyrosine kinases to participate in the signal transduction from the cell surface to the nucleus. It also dephosphorylates ROCK2 at Tyr-722 resulting in stimulatation of its RhoA binding activity.
References
  • Ganju R K, et al. (2000) Beta-chemokine receptor CCR5 signals through SHP1, SHP2, and Syk. J Biol Chem. 275(23):17263-8.
  • Yin T, et al. (1997) Molecular characterization of specific interactions between SHP-2 phosphatase and JAK tyrosine kinases. J Biol Chem. 272(2):1032-7.
  • Kontaridis MI, et al. (2006) PTPN11 (Shp2) mutations in LEOPARD syndrome have dominant negative, not activating, effects. J Biol Chem. 281(10):6785-92.
  • TOP