Mouse Serpinb3c Gene ORF cDNA clone expression plasmid,N terminal Myc tag

Gene

Species

Mouse

NCBI Ref Seq

NM_201363.2

RefSeq ORF Size

1161bp

Gene Synonym

Scca2, Serpinb4, 1110001H02Rik, 1110013A16Rik, Serpinb3c

Sequence Description

Identical with the Gene Bank Ref. ID sequence.

Description

Full length Clone DNA of Mouse serine (or cysteine) peptidase inhibitor, clade B, member 3C Gene ORF cDNA clone expression plasmid,N terminal Myc tag

Plasmid

Promoter

Enhanced CMV mammalian cell promoter

Vector

pCMV3-N-Myc

Restriction Site

Protein Tag

Myc

Tag Sequence

GAGCAGAAACTCATCTCAGAAGAGGATCTG

Sequencing Primers

Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)

Quality Control

The plasmid is confirmed by full-length sequencing.

Myc Tag Information

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Screening

Antibiotic in E.coli

Kanamycin

Antibiotic in Mammalian cell

Hygromycin

Application

Stable or Transient mammalian expression

Storage & Shipping

Shipping

Each tube contains lyophilized plasmid.

Storage

The lyophilized plasmid can be stored at ambient temperature for three months.

Other Life Science vendor

Natural small molecules manufacturer | Biological Research Reagents Manufacturer

Background Information

Serpins are the largest and most diverse family of serine protease inhibitors which are involved in a number of fundamental biological processes such as blood coagulation, complement activation, fibrinolysis, angiogenesis, inflammation and tumor suppression and are expressed in a cell-specific manner. Serpins are a group of proteins with similar structures that were first identified as a set of proteins able to inhibit proteases. The acronym serpin was originally coined because many serpins inhibit chymotrypsin-like serine proteases (serine protease inhibitors). Over 1000 serpins have been identified.
Mouse SerpinB3, also known as Squamous cell carcinoma antigen 1, SCCA-1, SERPINB3, SCCA and SCCA1, is a cytoplasm protein which belongs to the serpin family and Ov-serpin subfamily. SerpinB3 may act as a protease inhibitor to modulate the host immune response against tumor cells. Mouse SerpinB3a and SerpinB3b, but not Serpinb3c, are functional, inhibiting both serine and cysteine proteinases with different inhibitory profiles due to the difference of two amino acids in their reactive site loops. SerpinB3a is ubiquitously expressed in most tissues, whereas expression of SerpinB3b is limited to keratinocytes. SerpinB3a and SerpinB3b may play different roles by inhibiting intrinsic or extrinsic proteinases with different expression distributions and different inhibitory profiles.

References

Sakata,Y. et al., 2004, Biochem Biophys Res Commun.324 (4):1340-5.

Horvath, AJ. et al., 2004, J. Mol. Evol. 59: 488-97.

Steenbakkers PJ. et al., 2008, Mycol. Res. 112 (Pt 8): 999-1006.

Przygodzka, P. et al., 2010, BMC Cell Biol. 11: 30.

Catalog Number:MGG957-NM