Human SerpinA7 Gene ORF cDNA clone expression plasmid,N terminal Myc tag

Catalog Number:MGG949-NM

Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
1248bp
Gene Synonym
TBG,
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Human serpin peptidase inhibitor, clade A (alpha-1 antiproteinase, antitrypsin), member 7 Gene ORF cDNA clone expression plasmid,N terminal Myc tag
Plasmid
Promoter
Enhanced CMV mammalian cell promoter
Vector
pCMV3-N-Myc
Restriction Site
Protein Tag
Myc
Tag Sequence
GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)
Quality Control
The plasmid is confirmed by full-length sequencing.
Myc Tag Information

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
Background Information
Thyroxine-binding globulin, also known as T4-binding globulin, Serpin A7 and TBG, is a secreted protein which belongs to the serpin family. TBG is synthesized primarily in the liver as a 54 kDa protein.TBG is genomically a serpin, although it has no inhibitory function like many other members of this class of proteins. TBG binds thyroid hormone in circulation. It is one of three proteins (along with transthyretin and albumin) responsible for carrying the thyroid hormones thyroxine (T4) and 3,5,3’-triiodothyronine (T3) in the bloodstream. Of these three proteins, TBG has the highest affinity for T4 and T3, but is present in the lowest concentration. Despite its low concentration, TBG carries the majority of T4 in serum. Due to the very low serum concentration of T4 and T3, TBG is rarely more than 25% saturated with its ligand. Unlike transthyretin and albumin, TBG has a single binding site for T4/T3. TBG tests are sometimes used in finding the reason for elevated or diminished levels of thyroid hormone.
References
TOP