Mouse S100A9/MRP-14 Gene ORF cDNA clone expression plasmid,N terminal GFP tag

Catalog Number:MGG803-NG

Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
342bp
Gene Synonym
p14, Cagb, GAGB, L1Ag, BEE22, MRP14, 60B8Ag, AW546964, S100a9
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Mouse S100 calcium binding protein A9 (calgranulin B) Gene ORF cDNA clone expression plasmid,N terminal GFP tag
Plasmid
Promoter
Enhanced CMV mammalian cell promoter
Vector
pCMV3-N-GFPSpark
Restriction Site
Protein Tag
GFPSpark
Tag Sequence
GTGAGCAAGGGC……GAGCTGTACAAG
Sequencing Primers
Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)
Quality Control
The plasmid is confirmed by full-length sequencing.
GFPSpark Tag Information
GFPSpark is an improved variant of the green fluorescent protein GFP. It possesses bright green fluorescence (excitation/ emission max = 487 / 508 nm) that is visible earlier than fluorescence of other green fluorescent proteins. GFPSpark is mainly intended for applications where fast appearance of bright fluorescence is crucial. It is specially recommended for cell and organelle labeling and tracking the promoter activity.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
Background Information
S100 protein is a family of low molecular weight protein found in vertebrates characterized by two EF-hand calcium-binding motifs. There are at least 21 different S100 proteins, and the name is derived from the fact that the protein is 100% soluble in ammonium sulfate at neutral pH. Most S100 proteins are disulfide-linked homodimer, and is normally present in cells derived from the neural crest, chondrocytes, macrophages, dendritic cells, etc. S100 proteins have been implicated in a variety of intracellular and extracellular functions. They are involved in regulation of protein phosphorylation, transcription factors, the dynamics of cytoskeleton constituents, enzyme activities, cell growth and differentiation, and the inflammatory response. Protein S100-A9, also known as S100 calcium-binding protein A9, S100A9, and CAGB, is a member of the S-100 family. S100A9 is expressed by macrophages in acutely inflammed tissues and in chronic inflammation. It is also expressed in epithelial cells constitutively or induced during dermatoses. S100A9 is a calcium-binding protein. It has anti-microbial activity towards bacteria and fungi. The anti-microbial and proapoptotic activity of S100A9 is inhibited by zinc ions. S100A9 plays a role in the development of endotoxic shock in response to bacterial lipopolysaccharide (LPS). It promotes tubulin polymerization when unphosphorylated. It also promotes phagocyte migration and infiltration of granulocytes at sites of wounding. S100A9 plays a role as a pro-inflammatory mediator in acute and chronic inflammation and up-regulates the release of IL8 and cell-surface expression of ICAM1.
References
  • Miyasaki KT. et al., 1993, J Dent Res. 72: 517-23.
  • Fanò G. et al., 1995, Prog Neurobiol. 46 (1): 71-82.
  • Vogl T. et al., 2004, Blood. 104: 4260-8.
  • Viemann D. et al., 2005, Blood. 105: 2955-62.
  • Nakatani Y. et al., 2005, Mediators Inflamm. 2005: 280-92.
  • Bjoerk P. et al., 2009, PLoS Biol. 7: E97-E97.
  • TOP