Rhesus S100A8/MRP-8 Gene ORF cDNA clone expression plasmid,N terminal Myc tag

Gene

Species

Rhesus

NCBI Ref Seq

NM_001266907.2

RefSeq ORF Size

282bp

Gene Synonym

S100A8

Sequence Description

Identical with the Gene Bank Ref. ID sequence.

Description

Full length Clone DNA of Rhesus S100 calcium binding protein A8 Gene ORF cDNA clone expression plasmid,N terminal Myc tag

Plasmid

Promoter

Enhanced CMV mammalian cell promoter

Vector

pCMV3-N-Myc

Restriction Site

Protein Tag

Myc

Tag Sequence

GAGCAGAAACTCATCTCAGAAGAGGATCTG

Sequencing Primers

Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)

Quality Control

The plasmid is confirmed by full-length sequencing.

Myc Tag Information

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Screening

Antibiotic in E.coli

Kanamycin

Antibiotic in Mammalian cell

Hygromycin

Application

Stable or Transient mammalian expression

Storage & Shipping

Shipping

Each tube contains lyophilized plasmid.

Storage

The lyophilized plasmid can be stored at ambient temperature for three months.

Other Life Science vendor

Natural small molecules manufacturer | Biological Research Reagents Manufacturer

Background Information

S100A8 is a member of the S100 protein family containing 2EF-hand calcium-binding motifs. S100 proteins are involved in the regulation of a number of cellular processes such as cell cycle progression and differentiation. Altered expression of S100A8 protein is associated with various diseases and cancers. S100A8 may have an immunoregulatory role by contributing to the regulation of fetal-maternal interactions. It may play a protective role and its absence may allow infiltration by maternal cells, a process eventually manifesting as resorption. The heterodimeric S100 protein complex S100A8/A9 which has been shown to be involved in inflammatory and neoplastic disorders. The complex can induce cell proliferation, or apoptosis, inflammation, collagen synthesis, and cell migration. S100A8/A9 has emerged as important pro-inflammatory mediator in acute and chronic inflammation. More recently, increased S100A8 and S100A9 levels were also detected in various human cancers, presenting abundant expression in neoplastic tumor cells as well as infiltrating immune cells. On the one hand, S100A8/A9 is a powerful apoptotic agent produced by immune cells, making it a very fascinating tool in the battle against cancer. It spears the risk to induce auto-immune response and may serve as a lead compound for cancer-selective therapeutics. In contrast, S100A8/A9 expression in cancer cells has also been associated with tumor development, cancer invasion or metastasis. Altogether, its expression and potential cytokine-like function in inflammation and in cancer suggests that S100A8/A9 may play a key role in inflammation-associated cancer.

References

Passey RJ, et al. (1999) S100A8: emerging functions and regulation. J Leukoc Biol. 66(4): 549-56.

Gebhardt C, et al. (2006) S100A8 and S100A9 in inflammation and cancer. Biochem Pharmacol. 72(11): 1622-31.

Halayko AJ, et al. (2009) S100A8/A9: a mediator of severe asthma pathogenesis and morbidity? Can J Physiol Pharmacol. 87(10): 743-55.

Ghavami S, et al. (2009) S100A8/A9: a Janus-faced molecule in cancer therapy and tumorgenesis. Eur J Pharmacol. 625(1-3): 73-83.

Ha YS, et al. (2010) mRNA Expression of S100A8 as a Prognostic Marker for Progression of Non-Muscle-Invasive Bladder Cancer. Korean J Urol. 51(1): 15-20.

Catalog Number:MGG802-NM