Rat S100A6 Gene ORF cDNA clone expression plasmid,N terminal HA tag

Gene

Species

Rat

NCBI Ref Seq

NM_053485.2

RefSeq ORF Size

270bp

Gene Synonym

S100a6

Sequence Description

Identical with the Gene Bank Ref. ID sequence.

Description

Full length Clone DNA of Rat S100 calcium binding protein A6 Gene ORF cDNA clone expression plasmid,N terminal HA tag

Plasmid

Promoter

Enhanced CMV mammalian cell promoter

Vector

pCMV3-N-HA

Restriction Site

Protein Tag

HA

Tag Sequence

TATCCTTACGACGTGCCTGACTACGCC

Sequencing Primers

Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)

Quality Control

The plasmid is confirmed by full-length sequencing.

HA Tag Information

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Screening

Antibiotic in E.coli

Kanamycin

Antibiotic in Mammalian cell

Hygromycin

Application

Stable or Transient mammalian expression

Storage & Shipping

Shipping

Each tube contains lyophilized plasmid.

Storage

The lyophilized plasmid can be stored at ambient temperature for three months.

Other Life Science vendor

Natural small molecules manufacturer | Biological Research Reagents Manufacturer

Background Information

S100 protein is a family of low molecular weight protein found in vertebrates characterized by two EF-hand calcium-binding motifs. There are at least 21 different S100 proteins, and the name is derived from the fact that the protein is 100% soluble in ammonium sulfate at neutral pH. Most S100 proteins are disulfide-linked homodimer, and is normally present in cells derived from the neural crest, chondrocytes, macrophages, dendritic cells, etc. S100 proteins have been implicated in a variety of intracellular and extracellular functions. They are involved in regulation of protein phosphorylation, transcription factors, the dynamics of cytoskeleton constituents, enzyme activities, cell growth and differentiation, and the inflammatory response. S100A6 (S100 calcium binding protein A6) is a member of the S100 family of proteins, and functions in prolactin secretion, and exocytosis. Chromosomal rearrangements and altered expression of S100A6 have been implicated in melanoma.

References

Schäfer, B.W. et al., 1996, Trends Biochem. Sci. 21 (4): 134-140.

Donato,R. et al., 2003, Microsc. Res. Tech. 60 (6): 540-551.

Nowotny, M. et al., 2003, J. Biol. Chem. 278 (29): 26923-26928.

Nonaka D, et al., 2008, J. Cutan. Pathol. 35 (11): 1014-1019.

Marenholz, I. et al., 2004, Biochem. Biophys. Res. Commun. 322 (4): 1111-22.

Catalog Number:MGG800-NY