Mouse S100A3 Gene ORF cDNA clone expression plasmid,N terminal OFP tag

Catalog Number:MGG796-NO

Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
306bp
Gene Synonym
S100E, S100a3
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Mouse S100 calcium binding protein A3 Gene ORF cDNA clone expression plasmid,N terminal OFP tag
Plasmid
Promoter
Enhanced CMV mammalian cell promoter
Vector
pCMV3-N-OFPSpark
Restriction Site
Protein Tag
OFPSpark
Tag Sequence
GATAGCACTGAG……CACCTGTTCCAG
Sequencing Primers
Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)
Quality Control
The plasmid is confirmed by full-length sequencing.
OFPSpark Tag Information

OFPSpark is a red (orange) fluorescent protein (excitation/emission maxima are 549 and 566 nm, respectively) derived from DsRed. Possessing high photostability and pH stability, OFPSpark is more than twice brighter than mOrange2. Fast OFPSpark maturation makes it clearly detectable in mammalian cells as early as within 8 hrs after transfection. OFPSpark can be expressed and detected in a wide range of organisms. Mammalian cells transiently transfected with OFPSpark expression vectors produce bright fluorescence in 8 hrs after transfection. No cytotoxic effects or visible protein aggregation are observed. For its monomer structure, OFPSpark performs well in some fusions and protein labeling applications.

Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
Background Information
Protein S100-A3, also known as Protein S-100E, S100 calcium-binding protein A3, S100A3 and S100E, is a member of the S-100 family. S100A3 / S100E contains 2 EF-hand domains. S100A3 / S100E is highly expressed in the differentiating cuticular cells within the hair follicle and organized into mature hair cuticles. High concentrations of S100A3 homotetramer might provide the millimolar level of Ca2+ required for hair cuticular barrier formation. S100A3 / S100E is a unique member of the Ca2+-binding S100 protein family with the highest cysteine content and affinity for Zn2+. S100A3 / S100E binds both calcium and zinc. S100A3 / S100E probably binds 2 zinc ions per molecule. It may be involved in calcium-dependent cuticle cell differentiation and hair shaft formation. S100A3 plays an important role in calcium-dependent processes leading to hair shaft formation. S100A3 / S100E is a unique protein among all members of the calcium-binding S100 family, is specifically expressed at the inner endocuticle of human hair fibers. Upon hair damage, S100A3 / S100E is released from hair fibers and possibly destabilizes the hair tissue architecture.
References
  • Kizawa, K. et al., 2008, J Biol Chem. 283 (8):5004-13.
  • Kizawa, K. et al., 1998, J Invest Dermatol. 111 (5):879-86.
  • Kizawa, K. et al., 2002, Biochem Biophys Res Commun. 299 (5):857-62.
  • Fritz,G. et al., 2002, J Biol Chem. 277 (36):33092-8.
  • TOP