Mouse S100A15/S100A7A Gene ORF cDNA clone expression plasmid,C terminal HA tag

Catalog Number:MGG793-CY

Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
327bp
Gene Synonym
Gm1020, S100A7f, S100a15, AY465109, S100A7L1, MGC130261, MGC130262, S100a17l1, S100a7a
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Mouse S100 calcium binding protein A7A Gene ORF cDNA clone expression plasmid,C terminal HA tag
Plasmid
Promoter
Enhanced CMV mammalian cell promoter
Vector
pCMV3-C-HA
Restriction Site
Protein Tag
HA
Tag Sequence
TATCCTTACGACGTGCCTGACTACGCC
Sequencing Primers
Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)
Quality Control
The plasmid is confirmed by full-length sequencing.
HA Tag Information

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
Background Information
Koebnerisin is also known as protein S100-A7A (S100A7A), S100 calcium-binding protein A7-like 1 (S100A7L1) or S100 calcium-binding protein A15 (S100A15). Human S100A7A / S100A15 is a novel member of the S100 family of EF-hand calcium-binding proteins and was recently identified in psoriasis, where it is significantly upregulated in lesional skin. S100A7 is expressed by both normal cultured and malignant keratinocytes and malignant breast epithelial cells within ductal carcinoma in situ, suggesting an association with abnormal pathways of differentiation. S100A7 plays a role in the pathogenesis of inflammatory skin disease, as a chemotactic factor for hematopoietic cells. It also plays a role in early stages of breast tumor progression in association with the development of the invasive phenotype. The association of the 11.2 kDa S100A7A / S100A15 with psoriasis suggests that it contributes to the pathogenesis of the disease and could provide a molecular target for therapy. 
References
  • Wolf R, et al. (2009) Highly homologous hS100A15 and hS100A7 proteins are distinctly expressed in normal breast tissue and breast cancer. Cancer Lett. 277 (1): 101-7.
  • Buchau AS, et al. (2007) S100A15, an antimicrobial protein of the skin: regulation by E. coli through Toll-like receptor 4. J Invest Dermatol. 127 (11): 2596-604.
  • Boeshans KM, et al. (2006) Purification, crystallization and preliminary X-ray diffraction of human S100A15. Acta Crystallogr Sect F Struct Biol Cryst Commun. 62 (5): 467-70.
  • TOP