Mouse S100A13 Gene ORF cDNA clone expression plasmid,N terminal OFP tag

Gene

Species

Mouse

NCBI Ref Seq

NM_009113.3

RefSeq ORF Size

297bp

Gene Synonym

S100a13

Sequence Description

Identical with the Gene Bank Ref. ID sequence.

Description

Full length Clone DNA of Mouse S100 calcium binding protein A13 Gene ORF cDNA clone expression plasmid,N terminal OFP tag

Plasmid

Promoter

Enhanced CMV mammalian cell promoter

Vector

pCMV3-N-OFPSpark

Restriction Site

Protein Tag

OFPSpark

Tag Sequence

GATAGCACTGAG……CACCTGTTCCAG

Sequencing Primers

Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)

Quality Control

The plasmid is confirmed by full-length sequencing.

OFPSpark Tag Information

OFPSpark is a red (orange) fluorescent protein (excitation/emission maxima are 549 and 566 nm, respectively) derived from DsRed. Possessing high photostability and pH stability, OFPSpark is more than twice brighter than mOrange2. Fast OFPSpark maturation makes it clearly detectable in mammalian cells as early as within 8 hrs after transfection. OFPSpark can be expressed and detected in a wide range of organisms. Mammalian cells transiently transfected with OFPSpark expression vectors produce bright fluorescence in 8 hrs after transfection. No cytotoxic effects or visible protein aggregation are observed. For its monomer structure, OFPSpark performs well in some fusions and protein labeling applications.

Screening

Antibiotic in E.coli

Kanamycin

Antibiotic in Mammalian cell

Hygromycin

Application

Stable or Transient mammalian expression

Storage & Shipping

Shipping

Each tube contains lyophilized plasmid.

Storage

The lyophilized plasmid can be stored at ambient temperature for three months.

Other Life Science vendor

Natural small molecules manufacturer | Biological Research Reagents Manufacturer

Background Information

S100 protein is a family of low molecular weight protein found in vertebrates characterized by two EF-hand calcium-binding motifs. There are at least 21 different S100 proteins, and the name is derived from the fact that the protein is 100% soluble in ammonium sulfate at neutral pH. Most S100 proteins are disulfide-linked homodimer, and is normally present in cells derived from the neural crest, chondrocytes, macrophages, dendritic cells, etc. S100 proteins have been implicated in a variety of intracellular and extracellular functions. They are involved in regulation of protein phosphorylation, transcription factors, the dynamics of cytoskeleton constituents, enzyme activities, cell growth and differentiation, and the inflammatory response. Protein S100-A13, also known as S100 calcium-binding protein A13, is a member of the S-100 family. It contains two EF-hand domains. S100A13 binds two calcium ions per subunit and one copper ion. Binding of one copper ion does not interfere with calcium binding. S100A13 is required for the copper-dependent stress-induced export of IL1A and FGF1. The calcium-free protein binds to lipid vesicles containing phosphatidylserine, but not to vesicles containing phosphatidylcholine. S100A13 plays a role in the export of proteins that lack a signal peptide and are secreted by an alternative pathway.

References

Mandinova A. et al., 2003, J Cell Sci. 116: 2687-96.

Arnesano F. et al., 2005, Angew Chem Int Ed. 44: 6341-4.

Viemann D. et al., 2005, Blood. 105: 2955-62.

Nakatani Y. et al., 2005, Mediators Inflamm. 2005: 280-92.

Bjoerk P. et al., 2009, PLoS Biol. 7: E97-E97.

Catalog Number:MGG791-NO