Rat S100A11 / S100C Gene ORF cDNA clone expression plasmid,N terminal Myc tag

Gene

Species

Rat

NCBI Ref Seq

NM_001004095.1

RefSeq ORF Size

297bp

Gene Synonym

S100a11

Sequence Description

Identical with the Gene Bank Ref. ID sequence.

Description

Full length Clone DNA of Rat S100 calcium binding protein A11 Gene ORF cDNA clone expression plasmid,N terminal Myc tag

Plasmid

Promoter

Enhanced CMV mammalian cell promoter

Vector

pCMV3-N-Myc

Restriction Site

Protein Tag

Myc

Tag Sequence

GAGCAGAAACTCATCTCAGAAGAGGATCTG

Sequencing Primers

Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)

Quality Control

The plasmid is confirmed by full-length sequencing.

Myc Tag Information

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Screening

Antibiotic in E.coli

Kanamycin

Antibiotic in Mammalian cell

Hygromycin

Application

Stable or Transient mammalian expression

Storage & Shipping

Shipping

Each tube contains lyophilized plasmid.

Storage

The lyophilized plasmid can be stored at ambient temperature for three months.

Other Life Science vendor

Natural small molecules manufacturer | Biological Research Reagents Manufacturer

Background Information

Protein S100-A11, also known as S100 calcium-binding protein A11, S100A11 and MLN70, is a member of the S-100 family. S100A11 is widely expressed in multiple tissues, and is located in cytoplasm, nucleus, and even cell periphery. S100A11 exists as a non-covalent homodimer with an antiparallel conformation. Ca(2+) binding to S100A11 would trigger conformational changes which would expose the hydrophobic cleft of S100A11 and facilitate its interaction with target proteins. As a dual cell growth mediator, S100A11 acts as either a tumor suppressor or promoter in many different types of tumors and would play respective roles in influencing the proliferation of the cancer cells. In the nucleus, S100A11 suppresses the growth of keratinocytes through p21 (CIP1/WAF1) activation and induces cell differentiation. S100A11 is also a novel diagnostic marker in breast carcinoma.

References

Miyasaki KT. et al., 1993, J Dent Res. 72: 517-23.

Ohuchida K. et al., 2006, Clin Cancer Res 12 (18): 5417-22.

Kouno T. et al., 2008, J Pept Sci. 14 (10): 1129-38.

He H. et al., 2009, Cell Biochem Biophys 55 (3): 117-26.

Liu XG. et al., 2010, Oncol Rep. 23 (5): 1301-8.

Catalog Number:MGG789-NM