Mouse RSPO3 Gene ORF cDNA clone expression plasmid,C terminal OFP tag

Catalog Number:MGG756-CO

Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
834bp
Gene Synonym
Thsd2, AW742308, Cristin1, MGC118442, 2810459H04Rik, Rspo3
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Mouse R-spondin 3 homolog (Xenopus laevis) Gene ORF cDNA clone expression plasmid,C terminal OFP tag
Plasmid
Promoter
Enhanced CMV mammalian cell promoter
Vector
pCMV3-C-OFPSpark
Restriction Site
Protein Tag
OFPSpark
Tag Sequence
GATAGCACTGAG……CACCTGTTCCAG
Sequencing Primers
Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)
Quality Control
The plasmid is confirmed by full-length sequencing.
OFPSpark Tag Information

OFPSpark is a red (orange) fluorescent protein (excitation/emission maxima are 549 and 566 nm, respectively) derived from DsRed. Possessing high photostability and pH stability, OFPSpark is more than twice brighter than mOrange2. Fast OFPSpark maturation makes it clearly detectable in mammalian cells as early as within 8 hrs after transfection. OFPSpark can be expressed and detected in a wide range of organisms. Mammalian cells transiently transfected with OFPSpark expression vectors produce bright fluorescence in 8 hrs after transfection. No cytotoxic effects or visible protein aggregation are observed. For its monomer structure, OFPSpark performs well in some fusions and protein labeling applications.

Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
Background Information
R-spondin 3 (RSPO3) is a member of the R-Spondin (RSPO) family in vertebrates that activate Wnt/beta-catenin signaling, plays a key role in these processes. The RSPO family of secreted Wnt modulators is involved in development and disease and holds therapeutic promise as stem cell growth factors. The four members have high structural homology. RSPO2 and RSPO3 are more potent than RSPO1, whereas RSPO4 is relatively inactive. All RSPO members require Wnt ligands and LRP6 for activity and amplify signaling of Wnt3A, Wnt1, and Wnt7A, suggesting that RSPO proteins are general regulators of canonical Wnt signaling. RSPO3/PCP signaling during gastrulation requires Wnt5a and is transduced via Fz7, Dvl, and JNK. RSPO3 functions by inducing Sdc4-dependent, clathrin-mediated endocytosis. RSPO3 is a novel, evolutionarily conserved angiogenic factor in embryogenesis. RSPO3 has a key role in the interaction between chorion and allantois in labyrinthine development.
References
  • Aoki M, et al. (2007) R-spondin3 is required for mouse placental development. Dev Biol. 301(1): 218-26.
  • Kazanskaya O, et al. (2008) The Wnt signaling regulator R-spondin 3 promotes angioblast and vascular development. Development. 135(22): 3655-64.
  • Kim KA, et al. (2008) R-Spondin family members regulate the Wnt pathway by a common mechanism. Mol Biol Cell. 19(6): 2588-96.
  • Ohkawara B, et al. (2011) Rspo3 Binds Syndecan 4 and Induces Wnt/PCP Signaling via Clathrin-Mediated Endocytosis to Promote Morphogenesis. Dev Cell. 20(3): 303-14.
  • TOP