Rat RhoA Gene ORF cDNA clone expression plasmid,N terminal OFP tag

Catalog Number:MGG557-NO

Gene
Species
Rat
NCBI Ref Seq
RefSeq ORF Size
582bp
Gene Synonym
Arha, Arha2
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Rat ras homolog family member A Gene ORF cDNA clone expression plasmid,N terminal OFP tag
Plasmid
Promoter
Enhanced CMV mammalian cell promoter
Vector
pCMV3-N-OFPSpark
Restriction Site
Protein Tag
OFPSpark
Tag Sequence
GATAGCACTGAG……CACCTGTTCCAG
Sequencing Primers
Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)
Quality Control
The plasmid is confirmed by full-length sequencing.
OFPSpark Tag Information

OFPSpark is a red (orange) fluorescent protein (excitation/emission maxima are 549 and 566 nm, respectively) derived from DsRed. Possessing high photostability and pH stability, OFPSpark is more than twice brighter than mOrange2. Fast OFPSpark maturation makes it clearly detectable in mammalian cells as early as within 8 hrs after transfection. OFPSpark can be expressed and detected in a wide range of organisms. Mammalian cells transiently transfected with OFPSpark expression vectors produce bright fluorescence in 8 hrs after transfection. No cytotoxic effects or visible protein aggregation are observed. For its monomer structure, OFPSpark performs well in some fusions and protein labeling applications.

Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
Background Information
Transforming protein RhoA, also known as Rho cDNA clone 12, Ras homolog gene family member A, RHOA and ARH12, is a cell membrane and cytoplasm protein which belongs to the small GTPase superfamily and Rho family. The Rho family of small GTPases plays a key role in the dynamic regulation of the actin cytoskeleton that underlies various important cellular functions such as shape changes, migration, and polarity. RHOA / ARH12 is part of a larger family of related proteins known as the Ras superfamily; proteins involved in the regulation and timing of cell division. RHOA / ARH12 is a small GTPase protein known to regulate the actin cytoskeleton in the formation of stress fibers. It acts upon two known effector proteins: ROCK1 (Rho-associated, coiled-coil containing protein kinase 1) and DIAPH1 ( diaphanous homolog 1 (Drosophila) ). RHOA / ARH12 regulates a signal transduction pathway linking plasma membrane receptors to the assembly of focal adhesions and actin stress fibers. RHOA / ARH12 serves as a target for the yopT cysteine peptidase from Yersinia pestis, vector of the plague, and Yersinia pseudotuberculosis, which causes gastrointestinal disorders. RHOA / ARH12 may be an activator of PLCE1. It is activated by ARHGEF2, which promotes the exchange of GDP for GTP.
References
  • Kiss C, et al.,1997, Cytogenet. Cell Genet. 79 (3-4): 228-30.
  • Anastasiadis,P.Z. et al., 2000, Nat Cell Biol. 2 (9):637-44.
  • Yiu G, et al.,2006, Nat. Rev. Neurosci. 7 (8): 617-27.
  • Wang,HR. et al., 2006, Methods Enzymol. 406 :437-47.
  • Heo,J. et al., 2006, Biochemistry. 45 (48):14481-9.
  • TOP