Mouse RELA / Transcription factor p65 Gene ORF cDNA clone expression plasmid,C terminal Flag tag

Gene

Species

Mouse

NCBI Ref Seq

NM_009045.4

RefSeq ORF Size

1695 bp

Gene Synonym

p65

Sequence Description

Identical with the Gene Bank Ref. ID sequence.

Description

Full length Clone DNA of Mouse v-rel reticuloendotheliosis viral oncogene homolog A (avian) Gene ORF cDNA clone expression plasmid,C terminal Flag tag

Plasmid

Promoter

Enhanced CMV mammalian cell promoter

Vector

pCMV3-C-FLAG

Restriction Site

HindIII + XbaI(6kb+1.7kb)

Protein Tag

Flag

Tag Sequence

GATTACAAGGATGACGACGATAAG

Sequencing Primers

Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)

Quality Control

The plasmid is confirmed by full-length sequencing.

Flag Tag Information

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Screening

Antibiotic in E.coli

Kanamycin

Antibiotic in Mammalian cell

Hygromycin

Application

Stable or Transient mammalian expression

Storage & Shipping

Shipping

Each tube contains lyophilized plasmid.

Storage

The lyophilized plasmid can be stored at ambient temperature for three months.

Other Life Science vendor

Natural small molecules manufacturer | Biological Research Reagents Manufacturer

Background Information

RELA (v-rel reticuloendotheliosis viral oncogene homolog A), also known as Nuclear factor NF-kappa-B p65 subunit, or Transcription factor p65, is a transcription factor expressed in growth plate chondrocytes where it facilitates chondrogenesis. The v-rel avian reticuloendotheliosis viral oncogene homolog A (RELA) gene encodes the major component of the NF-?B complex. NF-kappaB is a generic name for an evolutionarily conserved transcription-factor system that contributes to the mounting of an effective immune response but is also involved in the regulation of cell proliferation, development, and apoptosis. The implication of NF-kappaB in central biological processes and its extraordinary connectivity to other signaling pathways raise a need for highly controlled regulation of NF-kappaB activity at several levels. The mammalian Rel/NF-kappaB family of transcription factors, including RelA, c-Rel, RelB, NF-kappaB1 (p50 and its precursor p105), and NF-kappaB2 (p52 and its precursor p100), plays a central role in the immune system by regulating several processes ranging from the development and survival of lymphocytes and lymphoid organs to the control of immune responses and malignant transformation.

References

Hashimoto R, et al. (2011) Variants of the RELA gene are associated with schizophrenia and their startle responses. Neuropsychopharmacology. 36(9): 1921-31.

Vallabhapurapu S, et al. (2009) Regulation and function of NF-kappaB transcription factors in the immune system. Annu Rev Immunol. 27: 693-733.

Schmitz ML, et al. (2004) NF-kappaB: a multifaceted transcription factor regulated at several levels. Chembiochem. 5(10): 1348-58.

Catalog Number:MGG488-CF