Human REG3G Gene ORF cDNA clone expression plasmid,N terminal Flag tag

Gene

Species

Human

NCBI Ref Seq

NM_001008387.1

RefSeq ORF Size

528bp

Gene Synonym

PAP1B, PAPIB, UNQ429, REG-III, MGC118998, MGC118999, MGC119001, REG3G

Sequence Description

Identical with the Gene Bank Ref. ID sequence.

Description

Full length Clone DNA of Human lumican Gene ORF cDNA clone expression plasmid,N terminal Flag tag

Plasmid

Promoter

Enhanced CMV mammalian cell promoter

Vector

pCMV3-N-FLAG

Restriction Site

Protein Tag

Flag

Tag Sequence

GATTACAAGGATGACGACGATAAG

Sequencing Primers

Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)

Quality Control

The plasmid is confirmed by full-length sequencing.

Flag Tag Information

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Screening

Antibiotic in E.coli

Kanamycin

Antibiotic in Mammalian cell

Hygromycin

Application

Stable or Transient mammalian expression

Storage & Shipping

Shipping

Each tube contains lyophilized plasmid.

Storage

The lyophilized plasmid can be stored at ambient temperature for three months.

Other Life Science vendor

Natural small molecules manufacturer | Biological Research Reagents Manufacturer

Background Information

Regenerating gene (Reg), first isolated from a regenerating islet cDNA library, encodes a secretory protein with a growth stimulating effect on pancreatic beta cells. Reg and Reg-related genes which were expressed in various organs have been revealed to constitute a multigene family, the Reg family, which consists of four subtypes (types I, II, III, IV) based on the primary structures of the encoded proteins of the genes, which are associated with tissue repair and have been directly implicated in pancreatic beta-cell regeneration. Reg proteins are expressed in various organs and are involved in cancers and neurodegenerative diseases. They display a typical C-type lectin-like domain but possess additional highly conserved amino acids. Regenerating islet-derived 3 gamma (REG3G), also known as pancreatitis-associated protein 1B (PAP1B), is a member of the secreted Reg superfamily and contains one typical C-type lectin domain. REG3G is expressed weakly in pancreas, strongly in intestinal tract, but not in hyperplastic islets REG3G might be a stress protein involved in the control of bacterial proliferation. It was indicated that REG3G specifically targets Gram-positive bacteria because it binds to their surface peptidoglycan layer, and serves as one of several antimicrobial peptides produced by paneth cells via stimulation of toll-like receptors (TLRs) by pathogen-associated molecular patterns (PAMPs).

References

Narushima Y, et al. (1997) Structure, chromosomal localization and expression of mouse genes encoding type III Reg, RegIII alpha, RegIII beta, RegIII gamma. Gene. 185(2): 159-68.

Nata K, et al. (2004) Molecular cloning, expression and chromosomal localization of a novel human REG family gene, REG III. Gene. 340(1): 161-70.

Laurine E, et al. (2005) PAP IB, a new member of the Reg gene family: cloning, expression, structural properties, and evolution by gene duplication. Biochim Biophys Acta. 1727(3): 177-87.

Castellarin ML, et al. (2007) The identification and sequence analysis of a new Reg3gamma and Reg2 in the Syrian golden hamster. Biochim Biophys Acta. 1769(9-10): 579-85.

Catalog Number:MGG485-NF