Mouse RAGE/AGER Gene ORF cDNA clone expression plasmid,N terminal Myc tag

Gene

Species

Mouse

NCBI Ref Seq

NM_007425.2

RefSeq ORF Size

1209bp

Gene Synonym

RAGE

Sequence Description

Identical with the Gene Bank Ref. ID sequence.

Description

Full length Clone DNA of Mouse advanced glycosylation end product-specific receptor Gene ORF cDNA clone expression plasmid,N terminal Myc tag

Plasmid

Promoter

Enhanced CMV mammalian cell promoter

Vector

pCMV3-N-Myc

Restriction Site

Protein Tag

Myc

Tag Sequence

GAGCAGAAACTCATCTCAGAAGAGGATCTG

Sequencing Primers

Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)

Quality Control

The plasmid is confirmed by full-length sequencing.

Myc Tag Information

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Screening

Antibiotic in E.coli

Kanamycin

Antibiotic in Mammalian cell

Hygromycin

Application

Stable or Transient mammalian expression

Storage & Shipping

Shipping

Each tube contains lyophilized plasmid.

Storage

The lyophilized plasmid can be stored at ambient temperature for three months.

Other Life Science vendor

Natural small molecules manufacturer | Biological Research Reagents Manufacturer

Background Information

Receptor for Advanced Glycosylation End Products (RAGE, or AGER) is a member of the immunoglobulin super-family transmembrane proteins, as a signal transduction receptor which binds advanced glycation endproducts, certain members of the S100/calgranulin family of proteins, high mobility group box 1 (HMGB1), advanced oxidation protein products, and amyloid (beta-sheet fibrils). Initial studies investigating the role of RAGE in renal dysfunction focused on diabetes, neurodegenerative disorders, and inflammatory responses. However, RAGE also has roles in the pathogenesis of renal disorders that are not associated with diabetes, such as obesity-related glomerulopathy, doxorubicin-induced nephropathy, hypertensive nephropathy, lupus nephritis, renal amyloidosis, and ischemic renal injuries. RAGE represents an important factor in innate immunity against pathogens, but it also interacts with endogenous ligands, resulting in chronic inflammation. RAGE signaling has been implicated in multiple human illnesses, including atherosclerosis, arthritis, Alzheimer's disease, atherosclerosis and aging associated diseases.

References

Zhou Z, et al. (2011) RAGE and its ligands in bone metabolism. Front Biosci (Schol Ed). 3: 768-76.

Mosquera JA. (2010) Role of the receptor for advanced glycation end products (RAGE) in inflammation]. Invest Clin. 51(2): 257-68.

D'Agati V, et al. (2010) RAGE and the pathogenesis of chronic kidney disease. Nat Rev Nephrol. 6(6): 352-60.

Catalog Number:MGG388-NM