Rat RACK1/GNB2L1 Gene ORF cDNA clone expression plasmid,C terminal OFP tag

Catalog Number:MGG375-CO

Gene
Species
Rat
NCBI Ref Seq
RefSeq ORF Size
954bp
Gene Synonym
RACK1
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Rat guanine nucleotide binding protein (G protein), beta polypeptide 2 like 1 Gene ORF cDNA clone expression plasmid,C terminal OFP tag
Plasmid
Promoter
Enhanced CMV mammalian cell promoter
Vector
pCMV3-C-OFPSpark
Restriction Site
Protein Tag
OFPSpark
Tag Sequence
GATAGCACTGAG……CACCTGTTCCAG
Sequencing Primers
Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)
Quality Control
The plasmid is confirmed by full-length sequencing.
OFPSpark Tag Information

OFPSpark is a red (orange) fluorescent protein (excitation/emission maxima are 549 and 566 nm, respectively) derived from DsRed. Possessing high photostability and pH stability, OFPSpark is more than twice brighter than mOrange2. Fast OFPSpark maturation makes it clearly detectable in mammalian cells as early as within 8 hrs after transfection. OFPSpark can be expressed and detected in a wide range of organisms. Mammalian cells transiently transfected with OFPSpark expression vectors produce bright fluorescence in 8 hrs after transfection. No cytotoxic effects or visible protein aggregation are observed. For its monomer structure, OFPSpark performs well in some fusions and protein labeling applications.

Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
Background Information
RACK1 (guanine nucleotide binding protein (G protein), beta polypeptide 2-like 1), also known as GNB2L1, contains 7 WD repeats and belongs to the WD repeat G protein beta family. In the liver, RACK1 is expressed at higher levels in activated hepatic stellate cells than in hepatocytes or Kupffer cells. It is up-regulated in hepatocellular carcinomas and in the adjacent non-tumor liver tissue. RACK1 is involved in the recruitment, assembly and/or regulation of a variety of signaling molecules. It interacts with a wide variety of proteins and plays a role in many cellular processes. GNB2L1 binds to and stabilizes activated protein kinase C (PKC), increasing PKC-mediated phosphorylation. RACK1 may recruit activated PKC to the ribosome, leading to phosphorylation of EIF6. It inhibits the activity of SRC kinases including SRC, LCK and YES1. RACK1 also inhibits cell growth by prolonging the G0/G1 phase of the cell cycle. It enhances phosphorylation of BMAL1 by PRKCA and inhibits transcriptional activity of the BMAL1-CLOCK heterodimer.
References
  • Jannot G, et al.. (2011) The ribosomal protein RACK1 is required for microRNA function in both C. elegans and humans. EMBO Rep. 12(6):581-6.
  • Wang F, et al. (2011) RACK1 regulates VEGF/Flt1-mediated cell migration via activation of a PI3K/Akt pathway. J Biol Chem. 286(11):9097-106.
  • Cao XX, et al. (2011) RACK1 promotes breast carcinoma migration/metastasis via activation of the RhoA/Rho kinase pathway. Breast Cancer Res Treat. 126(3):555-63.
  • Myklebust LM, et al. (2011) Receptor for activated protein C kinase 1 (RACK1) is overexpressed in papillary thyroid carcinoma. Thyroid. 21(11):1217-25.
  • TOP