Mouse RAC1 Gene ORF cDNA clone expression plasmid,C terminal Myc tag

Gene

Species

Mouse

NCBI Ref Seq

NM_009007.2

RefSeq ORF Size

579bp

Gene Synonym

AL023026, D5Ertd559e, Rac1

Sequence Description

Identical with the Gene Bank Ref. ID sequence.

Description

Full length Clone DNA of Mouse RAS-related C3 botulinum substrate 1 Gene ORF cDNA clone expression plasmid,C terminal Myc tag

Plasmid

Promoter

Enhanced CMV mammalian cell promoter

Vector

pCMV3-C-Myc

Restriction Site

Protein Tag

Myc

Tag Sequence

GAGCAGAAACTCATCTCAGAAGAGGATCTG

Sequencing Primers

Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)

Quality Control

The plasmid is confirmed by full-length sequencing.

Myc Tag Information

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Screening

Antibiotic in E.coli

Kanamycin

Antibiotic in Mammalian cell

Hygromycin

Application

Stable or Transient mammalian expression

Storage & Shipping

Shipping

Each tube contains lyophilized plasmid.

Storage

The lyophilized plasmid can be stored at ambient temperature for three months.

Other Life Science vendor

Natural small molecules manufacturer | Biological Research Reagents Manufacturer

Background Information

RAC1 is a GTPase which belongs to the RAS superfamily of small GTP-binding proteins. Members of this superfamily appear to regulate a diverse array of cellular events, including the control of cell growth, cytoskeletal reorganization, and the activation of protein kinases. Two transcript variants encoding different isoforms have been found for RAC1 gene. RAC1 is a plasma membrane-associated small GTPase which cycles between active GTP-bound and inactive GDP-bound states. In its active state, binds to a variety of effector proteins to regulate cellular responses such as secretory processes, phagocytosis of apoptotic cells, epithelial cell polarization and growth-factor induced formation of membrane ruffles. RAC1 p21/rho GDI heterodimer is the active component of the cytosolic factor sigma 1, which is involved in stimulation of the NADPH oxidase activity in macrophage. RAC1 is essential for the SPATA13-mediated regulation of cell migration and adhesion assembly and disassembly. RAC1's isoform B has an accelerated GEF-independent GDP/GTP exchange and an impaired GTP hydrolysis, which is restored partially by GTPase-activating proteins. It is able to bind to the GTPase-binding domain of PAK but not full-length PAK in a GTP-dependent manner, suggesting that the insertion does not completely abolish effector interaction.

References

Kogai T, et al.. (2012) Regulation of sodium iodide symporter gene expression by Rac1/p38β mitogen-activated protein kinase signaling pathway in MCF-7 breast cancer cells. J Biol Chem. 287(5):3292-300.

Osborn-Heaford HL, et al. (2012) Mitochondrial Rac1 GTPase import and electron transfer from cytochrome c are required for pulmonary fibrosis. J Biol Chem. 287(5):3301-12.

Chang MH, et al. (2012) Prognostic role of integrin β1, E-cadherin, and rac1 expression in small cell lung cancer. APMIS. 120(1):28-38.

Osborn-Heaford HL, et al. (2012) Mitochondrial Rac1 GTPase import and electron transfer from cytochrome c are required for pulmonary fibrosis. J Biol Chem. 287(5):3301-12.

Mattagajasingh SN, et al. (2012) Activation of Stat3 in endothelial cells following hypoxia-reoxygenation is mediated by Rac1 and protein Kinase C. Biochim Biophys Acta. 1823(5):997-1006.

Catalog Number:MGG372-CM