Human PTS Gene ORF cDNA clone expression plasmid,C terminal Myc tag

Gene

Species

Human

NCBI Ref Seq

BC009686

RefSeq ORF Size

438bp

Gene Synonym

FLJ97081, PTPS, PTS

Sequence Description

Identical with the Gene Bank Ref. ID sequence.

Description

Full length Clone DNA of Human 6-pyruvoyltetrahydropterin synthase Gene ORF cDNA clone expression plasmid,C terminal Myc tag

Plasmid

Promoter

Enhanced CMV mammalian cell promoter

Vector

pCMV3-C-Myc

Restriction Site

Protein Tag

Myc

Tag Sequence

GAGCAGAAACTCATCTCAGAAGAGGATCTG

Sequencing Primers

Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)

Quality Control

The plasmid is confirmed by full-length sequencing.

Myc Tag Information

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Screening

Antibiotic in E.coli

Kanamycin

Antibiotic in Mammalian cell

Hygromycin

Application

Stable or Transient mammalian expression

Storage & Shipping

Shipping

Each tube contains lyophilized plasmid.

Storage

The lyophilized plasmid can be stored at ambient temperature for three months.

Other Life Science vendor

Natural small molecules manufacturer | Biological Research Reagents Manufacturer

Background Information

PTS(6-pyruvoyltetrahydropterin synthase) belongs to the PTPS family. It catalyzes the elimination of inorganic triphosphate from dihydroneopterin triphosphate, which is the second and irreversible step in the biosynthesis of tetrahydrobiopterin from GTP. Tetrahydrobiopterin, also known as BH(4), is an essential cofactor and regulator of various enzyme activities, including enzymes involved in serotonin biosynthesis and NO synthase activity. Mutations in this gene result in hyperphenylalaninemia. PTS is involved in the biosynthesis of tetrahydrobiopterin, an essential cofactor of aromatic amino acid hydroxylases. PTS also catalyzes the transformation of 7,8-dihydroneopterin triphosphate into 6-pyruvoyl tetrahydropterin. Defects in PTS are the cause of BH4-deficient hyperphenylalaninemia type A (HPABH4A), also called 6-pyruvoyl-tetrahydropterin synthase deficiency (PTS deficiency) or hyperphenylalaninemia tetrahydrobiopterin-deficient due to PTS deficiency. HPABH4A is an autosomal recessive disorder characterized by depletion of the neurotransmitters dopamine and serotonin, and clinically by severe neurological symptoms unresponsive to the classic phenylalanine-low diet.

References

Ashida A, et al. (1994) A missense mutation (A to G) of 6-pyruvoyltetrahydropterin synthase in tetrahydrobiopterin-deficient form of hyperphenylalaninemia. Genomics. 24:408-10.

Ashida A, et al. (1993) cDNA cloning, expression in Escherichia coli and purification of human 6-pyruvoyl-tetrahydropterin synthase. Biochem. Biophys Res Commun. 195:1386-93.

Thoeny B, et al. (1992) Human 6-pyruvoyltetrahydropterin synthase: cDNA cloning and heterologous expression of the recombinant enzyme. Biochem Biophys Res Commun. 189:1437-43.

Catalog Number:MGG282-CM