Mouse PTPN6/SHP1 Gene ORF cDNA clone expression plasmid,C terminal Myc tag

Gene

Species

Mouse

NCBI Ref Seq

NM_001077705.1

RefSeq ORF Size

1794bp

Gene Synonym

me, hcp, Hcph, Ptp1C, SHP-1, motheaten, Ptpn6

Sequence Description

Identical with the Gene Bank Ref. ID sequence.

Description

Full length Clone DNA of Mouse protein tyrosine phosphatase, non-receptor type 6 Gene ORF cDNA clone expression plasmid,C terminal Myc tag

Plasmid

Promoter

Enhanced CMV mammalian cell promoter

Vector

pCMV3-C-Myc

Restriction Site

Protein Tag

Myc

Tag Sequence

GAGCAGAAACTCATCTCAGAAGAGGATCTG

Sequencing Primers

Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)

Quality Control

The plasmid is confirmed by full-length sequencing.

Myc Tag Information

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Screening

Antibiotic in E.coli

Kanamycin

Antibiotic in Mammalian cell

Hygromycin

Application

Stable or Transient mammalian expression

Storage & Shipping

Shipping

Each tube contains lyophilized plasmid.

Storage

The lyophilized plasmid can be stored at ambient temperature for three months.

Other Life Science vendor

Natural small molecules manufacturer | Biological Research Reagents Manufacturer

Background Information

PTPN6 is an enzyme which belongs to the protein tyrosine phosphatase (PTP) family. PTPs are signaling molecules that regulate a variety of cellular processes including cell growth, differentiation, mitotic cycle, and oncogenic transformation. N-terminal part of PTPN6 contains two tandem Src homolog (SH2) domains, which act as protein phospho-tyrosine binding domains, and mediate the interaction of PTPN6 with its substrates. PTPN6 is expressed primarily in hematopoietic cells, and functions as an important regulator of multiple signaling pathways in hematopoietic cells. It has been shown that PTPN6 interacts with, and dephosphorylate a wide spectrum of phospho-proteins involved in hematopoietic cell signaling.

References

Yu CL, et al. (2000) Cytosolic tyrosine dephosphorylation of STAT5. Potential role of SHP-2 in STAT5 regulation. J Biol Chem. 275(1):599-604.

Wu DW, et al. (2000) SH2-Containing protein tyrosine phosphatase-1 (SHP-1) association with Jak2 in UT-7/Epo cells. Blood Cells Mol Dis. 26(1):15-24.

Jiao H, et al. (1996) Direct association with and dephosphorylation of Jak2 kinase by the SH2-domain-containing protein tyrosine phosphatase SHP-1. Mol Cell Biol. 16(12):6985-92.

Catalog Number:MGG277-CM