Mouse PSPH Gene ORF cDNA clone expression plasmid,C terminal Flag tag

Gene

Species

Mouse

NCBI Ref Seq

NM_133900.4

RefSeq ORF Size

678bp

Gene Synonym

PSP; PSPase; AI480570

Sequence Description

Identical with the Gene Bank Ref. ID sequence.

Description

Full length Clone DNA of Mouse phosphoserine phosphatase Gene ORF cDNA clone expression plasmid,C terminal Flag tag

Plasmid

Promoter

Enhanced CMV mammalian cell promoter

Vector

pCMV3-C-FLAG

Restriction Site

Protein Tag

Flag

Tag Sequence

GATTACAAGGATGACGACGATAAG

Sequencing Primers

Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)

Quality Control

The plasmid is confirmed by full-length sequencing.

Flag Tag Information

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Screening

Antibiotic in E.coli

Kanamycin

Antibiotic in Mammalian cell

Hygromycin

Application

Stable or Transient mammalian expression

Storage & Shipping

Shipping

Each tube contains lyophilized plasmid.

Storage

The lyophilized plasmid can be stored at ambient temperature for three months.

Other Life Science vendor

Natural small molecules manufacturer | Biological Research Reagents Manufacturer

Background Information

Phosphoserine phosphatase (PSPH) belongs to a subfamily of the phosphotransferases. PSPH is the rate-limiting enzyme in l-serine biosynthesis. It has previously been found that Phosphoserine phosphatase (PSPH) plays a role in epidermal homeostasis. Phosphoserine phosphatase (PSP) catalyzes the hydrolysis of phosphoserine to serine. Phosphoserine phosphatase (PSPH) expression has been examined in human-mouse somatic cell hybrids retaining different combination of human chromosomes. Phosphoserine phosphatase (PSPH) is expressed throughout the proliferative layer of the epidermis and hair follicles in rodent and human skin and is highly induced in SCC. In keratinocytes, Phosphoserine phosphatase (PSPH) is a cytoplasmic protein that primarily localizes to endosomes and is present primarily as a homodimer. Knock down of Phosphoserine phosphatase (PSPH) dramatically diminished SCC cell proliferation and cyclin D1 levels in the presence of exogenous of l-serine production suggesting a non-canonical role for Phosphoserine phosphatase (PSPH) in epithelial carcinogenesis. Phosphoserine phosphatase (PSPH) is highly induced in proliferative normal keratinocytes and in skin tumors. Phosphoserine phosphatase (PSPH) appears to be critical for the proliferation of SCC cells; however, this phenomenon may not involve the phosphoserine metabolic pathway.

References

Bachelor MA, et al. (2011) L-3-Phosphoserine phosphatase (PSPH) regulates cutaneous squamous cell carcinoma proliferation independent of L-serine biosynthesis. J Dermatol Sci. 63(3): 164-72.

Koch GA, et al. (1983) Assignment of the human phosphoserine phosphatase gene (PSP) to the pter leads to q22 region of chromosome 7. Cytogenet Cell Genet. 35(1): 67-9.

Jaeken J, et al. (1997) Phosphoserine phosphatase deficiency in a patient with Williams syndrome. J Med Genet. 34(7): 594-6.

Catalog Number:MGG243-CF