Mouse PSMA/FOLH1/GCPII Gene ORF cDNA clone expression plasmid,C terminal Flag tag

Catalog Number:MGG203-CF

Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
2259bp
Gene Synonym
mopsm, MGC141397, Folh1
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Mouse folate hydrolase Gene ORF cDNA clone expression plasmid,C terminal Flag tag
Plasmid
Promoter
Enhanced CMV mammalian cell promoter
Vector
pCMV3-C-FLAG
Restriction Site
Protein Tag
Flag
Tag Sequence
GATTACAAGGATGACGACGATAAG
Sequencing Primers
Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)
Quality Control
The plasmid is confirmed by full-length sequencing.
Flag Tag Information

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
Background Information
Glutamate carboxypeptidase 2, also known as Glutamate carboxypeptidase II, Membrane glutamate carboxypeptidase, Prostate-specific membrane antigen, GCPII, PSMA, FOLH1, and NAALAD1, is a single-pass type I I membrane protein which belongs to the peptidase M28 family and M28B subfamily. FOLH1 is highly expressed in prostate epithelium. It is detected in urinary bladder, kidney, testis, ovary, fallopian tube, breast, adrenal gland, liver, esophagus, stomach, small intestine, colon, brain (at protein level), and the capillary endothelium of a variety of tumors. FOLH1 has both folate hydrolase and N-acetylated alpha linked acidic dipeptidase (NAALADase) activity. It has a preference for tri-alpha-glutamate peptides. Genetic variation in FOLH1 may be associated with low folate levels and consequent hyperhomocysteinemia. This condition can result in increased risk of cardiovascular disease, neural tube defects, and cognitive deficits. FOLH1 also shows a promising role in directed imaging and therapy of recurrent or metastatic disease.
References
TOP