Mouse PSGL-1/CD162 Gene ORF cDNA clone expression plasmid,C terminal Flag tag

Catalog Number:MGG201-CF

Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
1194bp
Gene Synonym
CD162, Psgl1, Selp1, Selpl, Psgl-1, Selplg
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Mouse selectin, platelet (p-selectin) ligand Gene ORF cDNA clone expression plasmid,C terminal Flag tag
Plasmid
Promoter
Enhanced CMV mammalian cell promoter
Vector
pCMV3-C-FLAG
Restriction Site
Protein Tag
Flag
Tag Sequence
GATTACAAGGATGACGACGATAAG
Sequencing Primers
Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)
Quality Control
The plasmid is confirmed by full-length sequencing.
Flag Tag Information

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
Background Information
P-selectin glycoprotein ligand-1 (PSGL-1), also known as SELPLG or CD162, is the high affinitycounter-receptor for P-selectin on expressed on activated endothelial cells and platelets. PSGL-1 is a mucin-type glycoprotein, expressed on leukocytes and platelets as a homodimer of two disulfide-linked subunits of ~120 kD. As cell adhesion molecules, multiple studies have shown that PSGL-1/ P-selectin interaction is required for the normal recruitment of leukocytes during inflammatory reactions, and also participates in hemostatic responses. PSGL-1 protein requires two distinct posttranslational modifications for the Ca2+-dependent recognition by the lectin domain of P-selectin, that is tyrosine sulfation and specific O-linked glycosylation (sialic acid and fucose). PSGL-1 can also bind to other two members of the selectin family, E-selectin (endothelial) and L-selectin (leukocyte), but binds best to P-selectin.
References

1. Sako, D. et al., 1993, Cell. 75: 1179-1186.

2. Wilkins, P. P. et al., 1995, J. Biol. Chem. 270: 22677-22680.

3. Frenette, P. S. et al., 2000, J. Exp. Med. 191: 1413-1422.

4. Vandendries, E.R .et al., 2004, Thromb. Haemost. 92: 459-466..

5. Pouyani, T. et al., 1995, Cell. 83: 333-343.

TOP